Incidental Mutation 'R1333:Fam163b'
ID156758
Institutional Source Beutler Lab
Gene Symbol Fam163b
Ensembl Gene ENSMUSG00000009216
Gene Namefamily with sequence similarity 163, member B
Synonyms
MMRRC Submission 039398-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R1333 (G1)
Quality Score161
Status Validated
Chromosome2
Chromosomal Location27110380-27142491 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to G at 27113647 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091233] [ENSMUST00000151224]
Predicted Effect probably benign
Transcript: ENSMUST00000091233
SMART Domains Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TSP1 50 106 5.14e-7 SMART
Pfam:ADAM_spacer1 214 331 5.4e-28 PFAM
low complexity region 345 358 N/A INTRINSIC
TSP1 573 629 8.15e-1 SMART
TSP1 631 692 1.85e-2 SMART
TSP1 694 744 4.15e-1 SMART
TSP1 747 796 9.98e-5 SMART
TSP1 803 861 4.95e-2 SMART
TSP1 863 914 2.53e-6 SMART
Pfam:PLAC 922 953 1.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139633
Predicted Effect probably benign
Transcript: ENSMUST00000151224
SMART Domains Protein: ENSMUSP00000127556
Gene: ENSMUSG00000009216

DomainStartEndE-ValueType
Pfam:FAM163 1 167 1.2e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169787
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 90.3%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A G 8: 113,705,173 probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Amt A G 9: 108,301,097 D301G probably benign Het
Arhgef26 T C 3: 62,340,323 V276A probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Ccdc63 T C 5: 122,108,161 T566A probably benign Het
Cdk5rap1 A G 2: 154,360,654 S219P probably damaging Het
Col1a2 T A 6: 4,515,684 probably null Het
Ctns G A 11: 73,184,997 T342I probably benign Het
Dst G A 1: 34,228,347 E4957K probably damaging Het
Frem2 T C 3: 53,549,731 T2067A probably benign Het
Gm7353 C T 7: 3,109,066 noncoding transcript Het
Gm9791 T C 3: 34,005,076 noncoding transcript Het
Grik2 G T 10: 49,527,991 T258N probably damaging Het
Herc3 T C 6: 58,887,493 L704P probably damaging Het
Hjurp A C 1: 88,266,046 V380G probably damaging Het
Ikbkap C T 4: 56,770,969 probably benign Het
Lrrc56 A G 7: 141,198,264 probably benign Het
Mast3 G A 8: 70,781,294 P187S probably damaging Het
Mier2 A G 10: 79,545,157 V231A probably benign Het
Muc5b A G 7: 141,868,407 T4427A possibly damaging Het
Nox4 A G 7: 87,246,864 S7G possibly damaging Het
Obscn G C 11: 59,080,317 Q2457E probably damaging Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slc1a1 A G 19: 28,835,211 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stat6 G C 10: 127,651,225 R200S possibly damaging Het
Stxbp5l C A 16: 37,247,869 probably null Het
Tanc1 A G 2: 59,843,491 S1647G probably benign Het
Tmem132d T A 5: 127,784,859 M733L probably benign Het
Unc13d A G 11: 116,073,555 probably benign Het
Usp24 T C 4: 106,342,353 S165P possibly damaging Het
Vmn1r9 T C 6: 57,071,630 I230T probably damaging Het
Zscan20 T C 4: 128,588,096 D591G possibly damaging Het
Other mutations in Fam163b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Fam163b APN 2 27113585 missense probably damaging 1.00
IGL01602:Fam163b APN 2 27112676 missense probably damaging 0.99
IGL01605:Fam163b APN 2 27112676 missense probably damaging 0.99
IGL02074:Fam163b APN 2 27113558 missense probably damaging 1.00
IGL02582:Fam163b APN 2 27113558 missense probably damaging 1.00
R0238:Fam163b UTSW 2 27112634 missense probably damaging 1.00
R0238:Fam163b UTSW 2 27112634 missense probably damaging 1.00
R0535:Fam163b UTSW 2 27112766 missense probably benign 0.05
R0611:Fam163b UTSW 2 27113571 missense probably damaging 1.00
R1768:Fam163b UTSW 2 27112862 missense possibly damaging 0.86
R2437:Fam163b UTSW 2 27112686 missense probably damaging 1.00
R5096:Fam163b UTSW 2 27112749 missense probably benign 0.00
R6277:Fam163b UTSW 2 27112751 missense probably benign 0.45
R7142:Fam163b UTSW 2 27113555 missense not run
Predicted Primers PCR Primer
(F):5'- GGATAGCTGACCACTGAACAGCAC -3'
(R):5'- ACCTTTTACAAACAGGGAAGCTGAGAC -3'

Sequencing Primer
(F):5'- GAAGTCTGGCTGTACCCTC -3'
(R):5'- ggaagctgagactaagaggtg -3'
Posted On2014-02-11