Incidental Mutation 'R1333:Cdk5rap1'
ID156761
Institutional Source Beutler Lab
Gene Symbol Cdk5rap1
Ensembl Gene ENSMUSG00000027487
Gene NameCDK5 regulatory subunit associated protein 1
Synonyms
MMRRC Submission 039398-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.773) question?
Stock #R1333 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location154335380-154373010 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154360654 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 219 (S219P)
Ref Sequence ENSEMBL: ENSMUSP00000105353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028990] [ENSMUST00000109730] [ENSMUST00000109731]
Predicted Effect probably damaging
Transcript: ENSMUST00000028990
AA Change: S219P

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028990
Gene: ENSMUSG00000027487
AA Change: S219P

DomainStartEndE-ValueType
Pfam:UPF0004 100 203 3.2e-31 PFAM
Elp3 247 486 4.83e-52 SMART
Pfam:TRAM 500 574 1.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109730
SMART Domains Protein: ENSMUSP00000105352
Gene: ENSMUSG00000027487

DomainStartEndE-ValueType
Pfam:UPF0004 100 181 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109731
AA Change: S219P

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105353
Gene: ENSMUSG00000027487
AA Change: S219P

DomainStartEndE-ValueType
Pfam:UPF0004 100 203 1.1e-31 PFAM
Elp3 247 486 4.83e-52 SMART
Pfam:TRAM 500 574 1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148289
Meta Mutation Damage Score 0.234 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 90.3%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of cyclin-dependent kinase 5 activity. This protein has also been reported to modify RNA by adding a methylthio-group and may thus have a dual function as an RNA methylthiotransferase and as an inhibitor of cyclin-dependent kinase 5 activity. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele show deficient mitochondrial tRNA modification, reduced mitochondrial protein synthesis, defects in oxidative phosphorylation, high susceptibility to stress-induced mitochondrial remodeling, and accelerated myopathy and cardiac dysfunction under stressed conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A G 8: 113,705,173 probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Amt A G 9: 108,301,097 D301G probably benign Het
Arhgef26 T C 3: 62,340,323 V276A probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Ccdc63 T C 5: 122,108,161 T566A probably benign Het
Col1a2 T A 6: 4,515,684 probably null Het
Ctns G A 11: 73,184,997 T342I probably benign Het
Dst G A 1: 34,228,347 E4957K probably damaging Het
Fam163b A G 2: 27,113,647 probably benign Het
Frem2 T C 3: 53,549,731 T2067A probably benign Het
Gm7353 C T 7: 3,109,066 noncoding transcript Het
Gm9791 T C 3: 34,005,076 noncoding transcript Het
Grik2 G T 10: 49,527,991 T258N probably damaging Het
Herc3 T C 6: 58,887,493 L704P probably damaging Het
Hjurp A C 1: 88,266,046 V380G probably damaging Het
Ikbkap C T 4: 56,770,969 probably benign Het
Lrrc56 A G 7: 141,198,264 probably benign Het
Mast3 G A 8: 70,781,294 P187S probably damaging Het
Mier2 A G 10: 79,545,157 V231A probably benign Het
Muc5b A G 7: 141,868,407 T4427A possibly damaging Het
Nox4 A G 7: 87,246,864 S7G possibly damaging Het
Obscn G C 11: 59,080,317 Q2457E probably damaging Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slc1a1 A G 19: 28,835,211 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stat6 G C 10: 127,651,225 R200S possibly damaging Het
Stxbp5l C A 16: 37,247,869 probably null Het
Tanc1 A G 2: 59,843,491 S1647G probably benign Het
Tmem132d T A 5: 127,784,859 M733L probably benign Het
Unc13d A G 11: 116,073,555 probably benign Het
Usp24 T C 4: 106,342,353 S165P possibly damaging Het
Vmn1r9 T C 6: 57,071,630 I230T probably damaging Het
Zscan20 T C 4: 128,588,096 D591G possibly damaging Het
Other mutations in Cdk5rap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Cdk5rap1 APN 2 154366036 missense probably damaging 1.00
IGL02162:Cdk5rap1 APN 2 154335569 missense probably damaging 0.98
IGL02626:Cdk5rap1 APN 2 154365960 critical splice donor site probably null
IGL03278:Cdk5rap1 APN 2 154370702 missense probably benign 0.00
R1052:Cdk5rap1 UTSW 2 154360599 missense possibly damaging 0.96
R1552:Cdk5rap1 UTSW 2 154370695 missense probably benign 0.00
R1553:Cdk5rap1 UTSW 2 154352251 missense probably damaging 1.00
R2107:Cdk5rap1 UTSW 2 154353246 missense probably benign 0.22
R3946:Cdk5rap1 UTSW 2 154348716 missense probably damaging 1.00
R4126:Cdk5rap1 UTSW 2 154368895 missense probably damaging 1.00
R4715:Cdk5rap1 UTSW 2 154361835 makesense probably null
R4865:Cdk5rap1 UTSW 2 154370956 critical splice acceptor site probably null
R4866:Cdk5rap1 UTSW 2 154370956 critical splice acceptor site probably null
R4867:Cdk5rap1 UTSW 2 154370956 critical splice acceptor site probably null
R4946:Cdk5rap1 UTSW 2 154368874 missense possibly damaging 0.91
R5087:Cdk5rap1 UTSW 2 154342395 missense probably damaging 1.00
R5319:Cdk5rap1 UTSW 2 154335569 missense possibly damaging 0.62
R5383:Cdk5rap1 UTSW 2 154350835 missense possibly damaging 0.78
R5582:Cdk5rap1 UTSW 2 154345974 missense probably benign 0.01
R5780:Cdk5rap1 UTSW 2 154345868 frame shift probably null
R6262:Cdk5rap1 UTSW 2 154370686 missense probably benign 0.04
R6274:Cdk5rap1 UTSW 2 154368241 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGAAAACAAACAagcggggcg -3'
(R):5'- GCACTGAGTTCCATCTCCAGCAAG -3'

Sequencing Primer
(F):5'- cgagaggcagaggcagg -3'
(R):5'- ATTTGAAAATAGGGGTTCAGTGC -3'
Posted On2014-02-11