Incidental Mutation 'R1333:Ccdc63'
ID156769
Institutional Source Beutler Lab
Gene Symbol Ccdc63
Ensembl Gene ENSMUSG00000043036
Gene Namecoiled-coil domain containing 63
Synonyms4921511C16Rik
MMRRC Submission 039398-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R1333 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location122108040-122140823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122108161 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 566 (T566A)
Ref Sequence ENSEMBL: ENSMUSP00000050582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014080] [ENSMUST00000058960] [ENSMUST00000111750] [ENSMUST00000111751] [ENSMUST00000139213] [ENSMUST00000146733] [ENSMUST00000150535] [ENSMUST00000152389] [ENSMUST00000155612]
Predicted Effect probably benign
Transcript: ENSMUST00000014080
SMART Domains Protein: ENSMUSP00000014080
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
EFh 28 56 2.81e-5 SMART
EFh 98 126 4.53e0 SMART
EFh 134 162 3.97e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000058960
AA Change: T566A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000050582
Gene: ENSMUSG00000043036
AA Change: T566A

DomainStartEndE-ValueType
coiled coil region 140 158 N/A INTRINSIC
coiled coil region 209 285 N/A INTRINSIC
low complexity region 308 318 N/A INTRINSIC
coiled coil region 393 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111750
SMART Domains Protein: ENSMUSP00000107379
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
EFh 28 56 2.81e-5 SMART
EFh 98 126 4.53e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111751
SMART Domains Protein: ENSMUSP00000107380
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
EFh 28 56 2.81e-5 SMART
EFh 98 126 4.53e0 SMART
EFh 134 162 3.97e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123913
Predicted Effect probably benign
Transcript: ENSMUST00000126006
SMART Domains Protein: ENSMUSP00000123261
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
PDB:2W4H|B 2 62 4e-8 PDB
SCOP:d1wdcb_ 10 62 4e-5 SMART
Blast:EFh 37 62 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139213
SMART Domains Protein: ENSMUSP00000114156
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
Pfam:EF-hand_7 6 54 7e-8 PFAM
Pfam:EF-hand_1 9 37 6.4e-8 PFAM
Pfam:EF-hand_6 9 40 6.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146733
SMART Domains Protein: ENSMUSP00000142592
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
Pfam:EF-hand_7 6 54 1.2e-6 PFAM
Pfam:EF-hand_1 9 37 1.1e-6 PFAM
Pfam:EF-hand_6 9 40 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150535
SMART Domains Protein: ENSMUSP00000120274
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
Pfam:EF-hand_7 6 54 6.2e-8 PFAM
Pfam:EF-hand_1 9 37 5.8e-8 PFAM
Pfam:EF-hand_6 9 40 5.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152744
Predicted Effect probably benign
Transcript: ENSMUST00000153816
SMART Domains Protein: ENSMUSP00000119627
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
Pfam:EF-hand_1 62 90 2.4e-8 PFAM
Pfam:EF-hand_6 62 91 7.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155612
SMART Domains Protein: ENSMUSP00000120105
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
EFh 9 37 2.81e-5 SMART
EFh 79 107 4.53e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198618
Meta Mutation Damage Score 0.1644 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 90.3%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A G 8: 113,705,173 probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Amt A G 9: 108,301,097 D301G probably benign Het
Arhgef26 T C 3: 62,340,323 V276A probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cdk5rap1 A G 2: 154,360,654 S219P probably damaging Het
Col1a2 T A 6: 4,515,684 probably null Het
Ctns G A 11: 73,184,997 T342I probably benign Het
Dst G A 1: 34,228,347 E4957K probably damaging Het
Fam163b A G 2: 27,113,647 probably benign Het
Frem2 T C 3: 53,549,731 T2067A probably benign Het
Gm7353 C T 7: 3,109,066 noncoding transcript Het
Gm9791 T C 3: 34,005,076 noncoding transcript Het
Grik2 G T 10: 49,527,991 T258N probably damaging Het
Herc3 T C 6: 58,887,493 L704P probably damaging Het
Hjurp A C 1: 88,266,046 V380G probably damaging Het
Ikbkap C T 4: 56,770,969 probably benign Het
Lrrc56 A G 7: 141,198,264 probably benign Het
Mast3 G A 8: 70,781,294 P187S probably damaging Het
Mier2 A G 10: 79,545,157 V231A probably benign Het
Muc5b A G 7: 141,868,407 T4427A possibly damaging Het
Nox4 A G 7: 87,246,864 S7G possibly damaging Het
Obscn G C 11: 59,080,317 Q2457E probably damaging Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slc1a1 A G 19: 28,835,211 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stat6 G C 10: 127,651,225 R200S possibly damaging Het
Stxbp5l C A 16: 37,247,869 probably null Het
Tanc1 A G 2: 59,843,491 S1647G probably benign Het
Tmem132d T A 5: 127,784,859 M733L probably benign Het
Unc13d A G 11: 116,073,555 probably benign Het
Usp24 T C 4: 106,342,353 S165P possibly damaging Het
Vmn1r9 T C 6: 57,071,630 I230T probably damaging Het
Zscan20 T C 4: 128,588,096 D591G possibly damaging Het
Other mutations in Ccdc63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Ccdc63 APN 5 122124919 splice site probably benign
IGL01660:Ccdc63 APN 5 122110964 missense possibly damaging 0.81
IGL01773:Ccdc63 APN 5 122113145 missense possibly damaging 0.93
IGL02341:Ccdc63 APN 5 122113198 missense probably benign 0.00
IGL03030:Ccdc63 APN 5 122122813 missense probably benign 0.00
IGL02991:Ccdc63 UTSW 5 122108212 missense probably benign 0.10
R0267:Ccdc63 UTSW 5 122117044 splice site probably benign
R0961:Ccdc63 UTSW 5 122110946 missense possibly damaging 0.75
R1802:Ccdc63 UTSW 5 122129877 missense probably damaging 1.00
R1999:Ccdc63 UTSW 5 122127565 missense possibly damaging 0.72
R2048:Ccdc63 UTSW 5 122130287 critical splice donor site probably null
R2150:Ccdc63 UTSW 5 122127565 missense possibly damaging 0.72
R2350:Ccdc63 UTSW 5 122122885 missense probably benign 0.04
R4049:Ccdc63 UTSW 5 122122750 missense probably damaging 0.99
R5072:Ccdc63 UTSW 5 122121055 missense probably benign 0.28
R5847:Ccdc63 UTSW 5 122116845 missense possibly damaging 0.78
R6031:Ccdc63 UTSW 5 122129736 missense possibly damaging 0.74
R6031:Ccdc63 UTSW 5 122129736 missense possibly damaging 0.74
R6249:Ccdc63 UTSW 5 122124999 missense probably benign 0.17
R6782:Ccdc63 UTSW 5 122111014 nonsense probably null
R7073:Ccdc63 UTSW 5 122111010 missense not run
X0028:Ccdc63 UTSW 5 122109175 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CATTCTCAGGGTTATCAAGGGCCAC -3'
(R):5'- AGCTCTAAAGGGCTTTCCAACCG -3'

Sequencing Primer
(F):5'- GTTATCAAGGGCCACATAGACCTC -3'
(R):5'- TGCTCAGCCCAGCATGATG -3'
Posted On2014-02-11