Incidental Mutation 'R1333:Bid'
ID156774
Institutional Source Beutler Lab
Gene Symbol Bid
Ensembl Gene ENSMUSG00000004446
Gene NameBH3 interacting domain death agonist
Synonyms
MMRRC Submission 039398-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R1333 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location120891930-120916853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120897255 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 110 (A110T)
Ref Sequence ENSEMBL: ENSMUSP00000125731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004560] [ENSMUST00000009256] [ENSMUST00000145948] [ENSMUST00000160684]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004560
AA Change: A110T

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000004560
Gene: ENSMUSG00000004446
AA Change: A110T

DomainStartEndE-ValueType
Pfam:BID 3 192 2.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000009256
SMART Domains Protein: ENSMUSP00000009256
Gene: ENSMUSG00000009112

DomainStartEndE-ValueType
low complexity region 51 67 N/A INTRINSIC
BCL 106 197 4.19e0 SMART
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145948
SMART Domains Protein: ENSMUSP00000117529
Gene: ENSMUSG00000004446

DomainStartEndE-ValueType
Pfam:BID 1 52 1.7e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160684
AA Change: A110T

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125731
Gene: ENSMUSG00000004446
AA Change: A110T

DomainStartEndE-ValueType
Pfam:BID 1 195 3.8e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161594
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 90.3%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a death agonist that heterodimerizes with either agonist BAX or antagonist BCL2. The encoded protein is a member of the BCL-2 family of cell death regulators. It is a mediator of mitochondrial damage induced by caspase-8 (CASP8); CASP8 cleaves this encoded protein, and the COOH-terminal part translocates to mitochondria where it triggers cytochrome c release. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants survive with little or no liver damage after injection with antibody against Fas, whereas mice normally die from hepatocellular apoptosis and hemorragic necrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A G 8: 113,705,173 probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Amt A G 9: 108,301,097 D301G probably benign Het
Arhgef26 T C 3: 62,340,323 V276A probably benign Het
Ccdc63 T C 5: 122,108,161 T566A probably benign Het
Cdk5rap1 A G 2: 154,360,654 S219P probably damaging Het
Col1a2 T A 6: 4,515,684 probably null Het
Ctns G A 11: 73,184,997 T342I probably benign Het
Dst G A 1: 34,228,347 E4957K probably damaging Het
Fam163b A G 2: 27,113,647 probably benign Het
Frem2 T C 3: 53,549,731 T2067A probably benign Het
Gm7353 C T 7: 3,109,066 noncoding transcript Het
Gm9791 T C 3: 34,005,076 noncoding transcript Het
Grik2 G T 10: 49,527,991 T258N probably damaging Het
Herc3 T C 6: 58,887,493 L704P probably damaging Het
Hjurp A C 1: 88,266,046 V380G probably damaging Het
Ikbkap C T 4: 56,770,969 probably benign Het
Lrrc56 A G 7: 141,198,264 probably benign Het
Mast3 G A 8: 70,781,294 P187S probably damaging Het
Mier2 A G 10: 79,545,157 V231A probably benign Het
Muc5b A G 7: 141,868,407 T4427A possibly damaging Het
Nox4 A G 7: 87,246,864 S7G possibly damaging Het
Obscn G C 11: 59,080,317 Q2457E probably damaging Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slc1a1 A G 19: 28,835,211 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stat6 G C 10: 127,651,225 R200S possibly damaging Het
Stxbp5l C A 16: 37,247,869 probably null Het
Tanc1 A G 2: 59,843,491 S1647G probably benign Het
Tmem132d T A 5: 127,784,859 M733L probably benign Het
Unc13d A G 11: 116,073,555 probably benign Het
Usp24 T C 4: 106,342,353 S165P possibly damaging Het
Vmn1r9 T C 6: 57,071,630 I230T probably damaging Het
Zscan20 T C 4: 128,588,096 D591G possibly damaging Het
Other mutations in Bid
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1331:Bid UTSW 6 120897255 missense possibly damaging 0.82
R1332:Bid UTSW 6 120897255 missense possibly damaging 0.82
R1335:Bid UTSW 6 120897255 missense possibly damaging 0.82
R1760:Bid UTSW 6 120900248 missense possibly damaging 0.65
R1930:Bid UTSW 6 120897255 missense possibly damaging 0.82
R1932:Bid UTSW 6 120897255 missense possibly damaging 0.82
R2152:Bid UTSW 6 120900254 missense probably damaging 1.00
R4937:Bid UTSW 6 120895746 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GGCAGTCAAGGACAGGGTTTACTTC -3'
(R):5'- CCGCAGCAGCAAGCATATAATCTGG -3'

Sequencing Primer
(F):5'- CCTGGGAAAGACTGGTTCGAC -3'
(R):5'- TCATGGTCCTCACTAGGGCAG -3'
Posted On2014-02-11