Incidental Mutation 'R1333:Nox4'
ID156776
Institutional Source Beutler Lab
Gene Symbol Nox4
Ensembl Gene ENSMUSG00000030562
Gene NameNADPH oxidase 4
Synonyms
MMRRC Submission 039398-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R1333 (G1)
Quality Score193
Status Validated
Chromosome7
Chromosomal Location87246096-87398710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87246864 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 7 (S7G)
Ref Sequence ENSEMBL: ENSMUSP00000070039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032781] [ENSMUST00000068829] [ENSMUST00000124057] [ENSMUST00000126887] [ENSMUST00000136577] [ENSMUST00000144267]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032781
AA Change: S7G

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032781
Gene: ENSMUSG00000030562
AA Change: S7G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 8.3e-21 PFAM
Pfam:FAD_binding_8 306 417 2.8e-17 PFAM
Pfam:NAD_binding_6 423 561 7.3e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000068829
AA Change: S7G

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070039
Gene: ENSMUSG00000030562
AA Change: S7G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 5.3e-27 PFAM
Pfam:FAD_binding_8 306 417 5.5e-17 PFAM
Pfam:NAD_binding_6 423 539 4.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124057
AA Change: S38G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000119365
Gene: ENSMUSG00000030562
AA Change: S38G

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 134 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124269
Predicted Effect probably benign
Transcript: ENSMUST00000126887
AA Change: S7G

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138336
Gene: ENSMUSG00000030562
AA Change: S7G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127138
Predicted Effect probably benign
Transcript: ENSMUST00000136577
AA Change: S7G

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138274
Gene: ENSMUSG00000030562
AA Change: S7G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144267
AA Change: S7G

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138143
Gene: ENSMUSG00000030562
AA Change: S7G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208077
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 90.3%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null allele display increased heart damage following pressure overload. Mice with a cardiomyocyte specific deletion show decreased damage following pressure overload. Mice homozygous for a different knock-out allele exhibit decreased suseptibility to bleomycin-induced fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A G 8: 113,705,173 probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Amt A G 9: 108,301,097 D301G probably benign Het
Arhgef26 T C 3: 62,340,323 V276A probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Ccdc63 T C 5: 122,108,161 T566A probably benign Het
Cdk5rap1 A G 2: 154,360,654 S219P probably damaging Het
Col1a2 T A 6: 4,515,684 probably null Het
Ctns G A 11: 73,184,997 T342I probably benign Het
Dst G A 1: 34,228,347 E4957K probably damaging Het
Fam163b A G 2: 27,113,647 probably benign Het
Frem2 T C 3: 53,549,731 T2067A probably benign Het
Gm7353 C T 7: 3,109,066 noncoding transcript Het
Gm9791 T C 3: 34,005,076 noncoding transcript Het
Grik2 G T 10: 49,527,991 T258N probably damaging Het
Herc3 T C 6: 58,887,493 L704P probably damaging Het
Hjurp A C 1: 88,266,046 V380G probably damaging Het
Ikbkap C T 4: 56,770,969 probably benign Het
Lrrc56 A G 7: 141,198,264 probably benign Het
Mast3 G A 8: 70,781,294 P187S probably damaging Het
Mier2 A G 10: 79,545,157 V231A probably benign Het
Muc5b A G 7: 141,868,407 T4427A possibly damaging Het
Obscn G C 11: 59,080,317 Q2457E probably damaging Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slc1a1 A G 19: 28,835,211 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stat6 G C 10: 127,651,225 R200S possibly damaging Het
Stxbp5l C A 16: 37,247,869 probably null Het
Tanc1 A G 2: 59,843,491 S1647G probably benign Het
Tmem132d T A 5: 127,784,859 M733L probably benign Het
Unc13d A G 11: 116,073,555 probably benign Het
Usp24 T C 4: 106,342,353 S165P possibly damaging Het
Vmn1r9 T C 6: 57,071,630 I230T probably damaging Het
Zscan20 T C 4: 128,588,096 D591G possibly damaging Het
Other mutations in Nox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Nox4 APN 7 87376216 missense possibly damaging 0.89
IGL02711:Nox4 APN 7 87396868 missense probably damaging 1.00
IGL03234:Nox4 APN 7 87317313 critical splice donor site probably null
IGL03286:Nox4 APN 7 87370141 splice site probably benign
LCD18:Nox4 UTSW 7 87243067 unclassified probably benign
R0717:Nox4 UTSW 7 87304890 nonsense probably null
R1033:Nox4 UTSW 7 87374413 missense probably damaging 0.99
R1135:Nox4 UTSW 7 87323789 missense probably damaging 1.00
R1477:Nox4 UTSW 7 87295866 missense probably benign 0.16
R1489:Nox4 UTSW 7 87304889 missense probably damaging 0.99
R1579:Nox4 UTSW 7 87370023 missense probably damaging 0.98
R1669:Nox4 UTSW 7 87295889 missense probably benign 0.01
R1742:Nox4 UTSW 7 87295818 missense possibly damaging 0.82
R1900:Nox4 UTSW 7 87360796 nonsense probably null
R2112:Nox4 UTSW 7 87372008 missense probably damaging 1.00
R2192:Nox4 UTSW 7 87374380 missense probably benign 0.02
R2496:Nox4 UTSW 7 87306750 missense probably benign 0.04
R2497:Nox4 UTSW 7 87295876 nonsense probably null
R4158:Nox4 UTSW 7 87396824 missense possibly damaging 0.95
R4160:Nox4 UTSW 7 87396824 missense possibly damaging 0.95
R4281:Nox4 UTSW 7 87297524 missense possibly damaging 0.77
R4685:Nox4 UTSW 7 87297508 missense probably benign 0.36
R4791:Nox4 UTSW 7 87304847 missense probably benign 0.35
R5001:Nox4 UTSW 7 87360803 missense probably damaging 0.96
R5091:Nox4 UTSW 7 87376242 missense probably damaging 1.00
R5174:Nox4 UTSW 7 87323766 missense probably benign 0.10
R5220:Nox4 UTSW 7 87374408 missense possibly damaging 0.91
R5278:Nox4 UTSW 7 87371926 missense probably damaging 1.00
R5723:Nox4 UTSW 7 87304973 intron probably benign
R5840:Nox4 UTSW 7 87360793 missense probably benign 0.00
R5852:Nox4 UTSW 7 87338964 missense probably damaging 0.98
X0021:Nox4 UTSW 7 87395678 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGACTCAGTACAGCCTTTGACC -3'
(R):5'- CATGGGATGCCCAATATAGGGAAGC -3'

Sequencing Primer
(F):5'- ACAGCCTTTGACCCTCGC -3'
(R):5'- TCCCTTGCATTGAGCAGGAAG -3'
Posted On2014-02-11