Incidental Mutation 'R1333:Lrrc56'
ID156777
Institutional Source Beutler Lab
Gene Symbol Lrrc56
Ensembl Gene ENSMUSG00000038637
Gene Nameleucine rich repeat containing 56
Synonyms
MMRRC Submission 039398-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R1333 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141194157-141210055 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 141198264 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026572] [ENSMUST00000047093] [ENSMUST00000070458] [ENSMUST00000084446] [ENSMUST00000097957] [ENSMUST00000124971] [ENSMUST00000144008] [ENSMUST00000168550] [ENSMUST00000209220]
Predicted Effect probably benign
Transcript: ENSMUST00000026572
SMART Domains Protein: ENSMUSP00000026572
Gene: ENSMUSG00000025499

DomainStartEndE-ValueType
RAS 1 166 1.12e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047093
SMART Domains Protein: ENSMUSP00000048691
Gene: ENSMUSG00000038637

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Pfam:LRR_4 138 177 9.1e-8 PFAM
LRRcap 212 230 4.44e-1 SMART
low complexity region 294 310 N/A INTRINSIC
low complexity region 390 404 N/A INTRINSIC
low complexity region 449 458 N/A INTRINSIC
low complexity region 474 496 N/A INTRINSIC
low complexity region 523 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070458
SMART Domains Protein: ENSMUSP00000063912
Gene: ENSMUSG00000038637

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Pfam:LRR_7 116 132 4e-2 PFAM
Pfam:LRR_8 116 171 8.7e-8 PFAM
Pfam:LRR_4 117 158 7.2e-11 PFAM
Pfam:LRR_1 139 159 2.9e-2 PFAM
LRRcap 212 230 4.44e-1 SMART
low complexity region 294 310 N/A INTRINSIC
low complexity region 390 404 N/A INTRINSIC
low complexity region 449 458 N/A INTRINSIC
low complexity region 474 496 N/A INTRINSIC
low complexity region 523 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084446
SMART Domains Protein: ENSMUSP00000081486
Gene: ENSMUSG00000038637

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Pfam:LRR_7 116 132 3.5e-2 PFAM
Pfam:LRR_8 116 171 6.9e-8 PFAM
Pfam:LRR_4 117 158 6.7e-11 PFAM
Pfam:LRR_6 136 160 5.9e-2 PFAM
Pfam:LRR_1 139 159 2.6e-2 PFAM
Pfam:LRR_6 157 182 4.1e-2 PFAM
Pfam:LRR_1 161 199 5.9e-2 PFAM
LRRcap 212 230 4.44e-1 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097957
SMART Domains Protein: ENSMUSP00000095570
Gene: ENSMUSG00000025499

DomainStartEndE-ValueType
RAS 1 166 1.12e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124971
SMART Domains Protein: ENSMUSP00000138189
Gene: ENSMUSG00000025499

DomainStartEndE-ValueType
RAS 1 108 4.18e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128993
Predicted Effect probably benign
Transcript: ENSMUST00000144008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150141
Predicted Effect probably benign
Transcript: ENSMUST00000168550
SMART Domains Protein: ENSMUSP00000132110
Gene: ENSMUSG00000025499

DomainStartEndE-ValueType
RAS 1 158 4.97e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209220
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 90.3%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A G 8: 113,705,173 probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Amt A G 9: 108,301,097 D301G probably benign Het
Arhgef26 T C 3: 62,340,323 V276A probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Ccdc63 T C 5: 122,108,161 T566A probably benign Het
Cdk5rap1 A G 2: 154,360,654 S219P probably damaging Het
Col1a2 T A 6: 4,515,684 probably null Het
Ctns G A 11: 73,184,997 T342I probably benign Het
Dst G A 1: 34,228,347 E4957K probably damaging Het
Fam163b A G 2: 27,113,647 probably benign Het
Frem2 T C 3: 53,549,731 T2067A probably benign Het
Gm7353 C T 7: 3,109,066 noncoding transcript Het
Gm9791 T C 3: 34,005,076 noncoding transcript Het
Grik2 G T 10: 49,527,991 T258N probably damaging Het
Herc3 T C 6: 58,887,493 L704P probably damaging Het
Hjurp A C 1: 88,266,046 V380G probably damaging Het
Ikbkap C T 4: 56,770,969 probably benign Het
Mast3 G A 8: 70,781,294 P187S probably damaging Het
Mier2 A G 10: 79,545,157 V231A probably benign Het
Muc5b A G 7: 141,868,407 T4427A possibly damaging Het
Nox4 A G 7: 87,246,864 S7G possibly damaging Het
Obscn G C 11: 59,080,317 Q2457E probably damaging Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slc1a1 A G 19: 28,835,211 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stat6 G C 10: 127,651,225 R200S possibly damaging Het
Stxbp5l C A 16: 37,247,869 probably null Het
Tanc1 A G 2: 59,843,491 S1647G probably benign Het
Tmem132d T A 5: 127,784,859 M733L probably benign Het
Unc13d A G 11: 116,073,555 probably benign Het
Usp24 T C 4: 106,342,353 S165P possibly damaging Het
Vmn1r9 T C 6: 57,071,630 I230T probably damaging Het
Zscan20 T C 4: 128,588,096 D591G possibly damaging Het
Other mutations in Lrrc56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02619:Lrrc56 APN 7 141207633 unclassified probably benign
IGL02886:Lrrc56 APN 7 141197177 splice site probably benign
IGL03290:Lrrc56 APN 7 141199772 splice site probably benign
IGL03348:Lrrc56 APN 7 141207240 missense probably benign 0.01
R0624:Lrrc56 UTSW 7 141206453 missense probably damaging 1.00
R1385:Lrrc56 UTSW 7 141205525 missense probably damaging 1.00
R1857:Lrrc56 UTSW 7 141207508 missense probably benign
R1858:Lrrc56 UTSW 7 141207508 missense probably benign
R1859:Lrrc56 UTSW 7 141207508 missense probably benign
R2234:Lrrc56 UTSW 7 141198294 missense probably damaging 1.00
R2324:Lrrc56 UTSW 7 141205563 splice site probably benign
R3807:Lrrc56 UTSW 7 141209385 missense probably benign
R5347:Lrrc56 UTSW 7 141209624 missense probably benign 0.00
R6194:Lrrc56 UTSW 7 141205651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGCTCCCCAAGGTATCCACTG -3'
(R):5'- ACATGCTGCCCAAGGTGTTTGC -3'

Sequencing Primer
(F):5'- CTGAAGATCTCATCTGGAGACTG -3'
(R):5'- TTTACAACCAGGAAATACAATTGGC -3'
Posted On2014-02-11