Mutagenetix > Incidental Mutation

Incidental Mutation 'R1333:Mast3'

156779

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

039398-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1333 (G1)

Quality Score

182

Status

Validated

Chromosome

Chromosomal Location

71230761-71257681 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 71233938 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 187 (P187S)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000034296

SMART Domains

Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
SH3	7	79	4e-7	SMART
RhoGAP	122	286	2.36e-18	SMART
low complexity region	291	311	N/A	INTRINSIC
SH2	322	405	4.51e-26	SMART
Pfam:PI3K_P85_iSH2	422	590	1.7e-64	PFAM
SH2	614	696	9.96e-28	SMART
low complexity region	713	718	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142370

Predicted Effect

probably damaging
Transcript: ENSMUST00000166004
AA Change: P952S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: P952S

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191396

Predicted Effect

probably damaging
Transcript: ENSMUST00000211948
AA Change: P936S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212140
AA Change: P187S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Meta Mutation Damage Score

0.1052

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.2%
20x: 90.3%

Validation Efficiency

98% (41/42)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts18	A	G	8: 114,431,805 (GRCm39)		probably benign	Het
Amph	G	A	13: 19,326,198 (GRCm39)	V643M	probably damaging	Het
Amt	A	G	9: 108,178,296 (GRCm39)	D301G	probably benign	Het
Arhgef26	T	C	3: 62,247,744 (GRCm39)	V276A	probably benign	Het
Bid	C	T	6: 120,874,216 (GRCm39)	A110T	possibly damaging	Het
Ccdc63	T	C	5: 122,246,224 (GRCm39)	T566A	probably benign	Het
Cdk5rap1	A	G	2: 154,202,574 (GRCm39)	S219P	probably damaging	Het
Col1a2	T	A	6: 4,515,684 (GRCm39)		probably null	Het
Ctns	G	A	11: 73,075,823 (GRCm39)	T342I	probably benign	Het
Dst	G	A	1: 34,267,428 (GRCm39)	E4957K	probably damaging	Het
Elp1	C	T	4: 56,770,969 (GRCm39)		probably benign	Het
Fam163b	A	G	2: 27,003,659 (GRCm39)		probably benign	Het
Frem2	T	C	3: 53,457,152 (GRCm39)	T2067A	probably benign	Het
Gm7353	C	T	7: 3,159,066 (GRCm39)		noncoding transcript	Het
Gm9791	T	C	3: 34,059,225 (GRCm39)		noncoding transcript	Het
Grik2	G	T	10: 49,404,087 (GRCm39)	T258N	probably damaging	Het
Herc3	T	C	6: 58,864,478 (GRCm39)	L704P	probably damaging	Het
Hjurp	A	C	1: 88,193,768 (GRCm39)	V380G	probably damaging	Het
Lrrc56	A	G	7: 140,778,177 (GRCm39)		probably benign	Het
Mier2	A	G	10: 79,380,991 (GRCm39)	V231A	probably benign	Het
Muc5b	A	G	7: 141,422,144 (GRCm39)	T4427A	possibly damaging	Het
Nox4	A	G	7: 86,896,072 (GRCm39)	S7G	possibly damaging	Het
Obscn	G	C	11: 58,971,143 (GRCm39)	Q2457E	probably damaging	Het
Sh3bgrl2	C	T	9: 83,459,684 (GRCm39)		probably benign	Het
Slc1a1	A	G	19: 28,812,611 (GRCm39)		probably benign	Het
Snrnp40	C	G	4: 130,271,836 (GRCm39)		probably null	Het
Stard9	C	A	2: 120,504,117 (GRCm39)	S221R	probably damaging	Het
Stat6	G	C	10: 127,487,094 (GRCm39)	R200S	possibly damaging	Het
Stxbp5l	C	A	16: 37,068,231 (GRCm39)		probably null	Het
Tanc1	A	G	2: 59,673,835 (GRCm39)	S1647G	probably benign	Het
Tmem132d	T	A	5: 127,861,923 (GRCm39)	M733L	probably benign	Het
Unc13d	A	G	11: 115,964,381 (GRCm39)		probably benign	Het
Usp24	T	C	4: 106,199,550 (GRCm39)	S165P	possibly damaging	Het
Vmn1r9	T	C	6: 57,048,615 (GRCm39)	I230T	probably damaging	Het
Zscan20	T	C	4: 128,481,889 (GRCm39)	D591G	possibly damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	71,233,327 (GRCm39)	splice site	probably benign
IGL01411:Mast3	APN	8	71,232,227 (GRCm39)	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	71,232,174 (GRCm39)	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	71,234,783 (GRCm39)	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	71,240,550 (GRCm39)	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	71,241,888 (GRCm39)	missense	probably benign	0.36
IGL02437:Mast3	APN	8	71,233,202 (GRCm39)	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	71,239,519 (GRCm39)	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	71,241,861 (GRCm39)	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	71,234,207 (GRCm39)	nonsense	probably null
gravy	UTSW	8	71,239,279 (GRCm39)	missense	probably damaging	1.00
stuffing	UTSW	8	71,237,441 (GRCm39)	frame shift	probably null
turkey	UTSW	8	71,238,126 (GRCm39)	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	71,239,279 (GRCm39)	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	71,239,279 (GRCm39)	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	71,236,343 (GRCm39)	critical splice donor site	probably null
R0280:Mast3	UTSW	8	71,240,564 (GRCm39)	missense	possibly damaging	0.65
R0280:Mast3	UTSW	8	71,236,439 (GRCm39)	missense	probably damaging	1.00
R0731:Mast3	UTSW	8	71,233,965 (GRCm39)	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	71,239,307 (GRCm39)	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	71,232,968 (GRCm39)	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	71,240,916 (GRCm39)	splice site	probably null
R1208:Mast3	UTSW	8	71,240,916 (GRCm39)	splice site	probably null
R1543:Mast3	UTSW	8	71,244,955 (GRCm39)	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	71,238,816 (GRCm39)	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	71,237,200 (GRCm39)	missense	probably benign	0.38
R1842:Mast3	UTSW	8	71,233,037 (GRCm39)	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	71,237,444 (GRCm39)	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	71,240,007 (GRCm39)	missense	probably benign	0.00
R2219:Mast3	UTSW	8	71,233,607 (GRCm39)	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	71,233,607 (GRCm39)	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	71,232,251 (GRCm39)	missense	probably benign	0.13
R3919:Mast3	UTSW	8	71,232,066 (GRCm39)	missense	probably benign	0.02
R4027:Mast3	UTSW	8	71,240,552 (GRCm39)	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	71,233,838 (GRCm39)	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	71,233,838 (GRCm39)	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	71,233,838 (GRCm39)	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	71,233,838 (GRCm39)	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	71,233,251 (GRCm39)	nonsense	probably null
R4672:Mast3	UTSW	8	71,237,441 (GRCm39)	frame shift	probably null
R4770:Mast3	UTSW	8	71,238,864 (GRCm39)	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	71,233,010 (GRCm39)	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	71,241,559 (GRCm39)	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	71,240,889 (GRCm39)	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	71,236,145 (GRCm39)	missense	probably benign	0.03
R5428:Mast3	UTSW	8	71,237,377 (GRCm39)	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	71,238,865 (GRCm39)	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	71,240,577 (GRCm39)	missense	probably benign	0.00
R6177:Mast3	UTSW	8	71,242,662 (GRCm39)	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	71,238,127 (GRCm39)	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	71,234,772 (GRCm39)	missense	probably benign	0.02
R6614:Mast3	UTSW	8	71,234,610 (GRCm39)	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	71,239,376 (GRCm39)	missense	probably benign	0.29
R6873:Mast3	UTSW	8	71,239,236 (GRCm39)	nonsense	probably null
R6930:Mast3	UTSW	8	71,252,115 (GRCm39)	nonsense	probably null
R6948:Mast3	UTSW	8	71,238,126 (GRCm39)	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	71,232,117 (GRCm39)	missense	probably benign	0.14
R7253:Mast3	UTSW	8	71,242,326 (GRCm39)	critical splice donor site	probably null
R7316:Mast3	UTSW	8	71,232,432 (GRCm39)	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	71,237,503 (GRCm39)	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	71,238,815 (GRCm39)	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	71,232,947 (GRCm39)	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	71,232,947 (GRCm39)	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	71,241,412 (GRCm39)	missense	probably benign	0.16
R7576:Mast3	UTSW	8	71,233,838 (GRCm39)	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	71,239,279 (GRCm39)	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	71,236,214 (GRCm39)	missense	probably benign
R8021:Mast3	UTSW	8	71,240,896 (GRCm39)	missense	probably benign	0.02
R8204:Mast3	UTSW	8	71,240,925 (GRCm39)	missense	probably benign	0.00
R8327:Mast3	UTSW	8	71,232,062 (GRCm39)	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	71,233,085 (GRCm39)	missense	probably benign	0.39
R8415:Mast3	UTSW	8	71,233,866 (GRCm39)	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	71,233,085 (GRCm39)	missense	probably benign	0.39
R8530:Mast3	UTSW	8	71,240,877 (GRCm39)	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	71,233,801 (GRCm39)	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	71,234,377 (GRCm39)	splice site	probably benign
R9002:Mast3	UTSW	8	71,233,904 (GRCm39)	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	71,249,361 (GRCm39)	missense	unknown
R9087:Mast3	UTSW	8	71,242,330 (GRCm39)	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	71,233,091 (GRCm39)	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	71,238,826 (GRCm39)	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	71,238,127 (GRCm39)	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	71,241,682 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGCAGCCATAAAAGGCTCGTGGTG -3'
(R):5'- TCTAGAACTGGACACAAGGCCAAGC -3'

Sequencing Primer
(F):5'- ggggtgggCGGACAAAG -3'
(R):5'- ACAAGGCCAAGCGCCAG -3'

Posted On

2014-02-11