Incidental Mutation 'R1333:Stat6'
ID156785
Institutional Source Beutler Lab
Gene Symbol Stat6
Ensembl Gene ENSMUSG00000002147
Gene Namesignal transducer and activator of transcription 6
Synonyms
MMRRC Submission 039398-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.626) question?
Stock #R1333 (G1)
Quality Score148
Status Validated
Chromosome10
Chromosomal Location127642986-127660957 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 127651225 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 200 (R200S)
Ref Sequence ENSEMBL: ENSMUSP00000089708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092074] [ENSMUST00000120279]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092074
AA Change: R200S

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000089708
Gene: ENSMUSG00000002147
AA Change: R200S

DomainStartEndE-ValueType
STAT_int 2 116 2.76e-31 SMART
Pfam:STAT_bind 273 526 4.4e-87 PFAM
SH2 540 622 1.33e-5 SMART
Pfam:STAT6_C 655 837 1.1e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120279
SMART Domains Protein: ENSMUSP00000112722
Gene: ENSMUSG00000002147

DomainStartEndE-ValueType
Pfam:STAT_int 2 109 2.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128072
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 90.3%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein plays a central role in exerting IL4 mediated biological responses. It is found to induce the expression of BCL2L1/BCL-X(L), which is responsible for the anti-apoptotic activity of IL4. Knockout studies in mice suggested the roles of this gene in differentiation of T helper 2 (Th2) cells, expression of cell surface markers, and class switch of immunoglobulins. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired IL4 responses, including anti-IgM stimulated B cell proliferation, class switching to IgE, contact sensitivity, and Th2 cytokine production, and show increased resistance to certain infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A G 8: 113,705,173 probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Amt A G 9: 108,301,097 D301G probably benign Het
Arhgef26 T C 3: 62,340,323 V276A probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Ccdc63 T C 5: 122,108,161 T566A probably benign Het
Cdk5rap1 A G 2: 154,360,654 S219P probably damaging Het
Col1a2 T A 6: 4,515,684 probably null Het
Ctns G A 11: 73,184,997 T342I probably benign Het
Dst G A 1: 34,228,347 E4957K probably damaging Het
Fam163b A G 2: 27,113,647 probably benign Het
Frem2 T C 3: 53,549,731 T2067A probably benign Het
Gm7353 C T 7: 3,109,066 noncoding transcript Het
Gm9791 T C 3: 34,005,076 noncoding transcript Het
Grik2 G T 10: 49,527,991 T258N probably damaging Het
Herc3 T C 6: 58,887,493 L704P probably damaging Het
Hjurp A C 1: 88,266,046 V380G probably damaging Het
Ikbkap C T 4: 56,770,969 probably benign Het
Lrrc56 A G 7: 141,198,264 probably benign Het
Mast3 G A 8: 70,781,294 P187S probably damaging Het
Mier2 A G 10: 79,545,157 V231A probably benign Het
Muc5b A G 7: 141,868,407 T4427A possibly damaging Het
Nox4 A G 7: 87,246,864 S7G possibly damaging Het
Obscn G C 11: 59,080,317 Q2457E probably damaging Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slc1a1 A G 19: 28,835,211 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stxbp5l C A 16: 37,247,869 probably null Het
Tanc1 A G 2: 59,843,491 S1647G probably benign Het
Tmem132d T A 5: 127,784,859 M733L probably benign Het
Unc13d A G 11: 116,073,555 probably benign Het
Usp24 T C 4: 106,342,353 S165P possibly damaging Het
Vmn1r9 T C 6: 57,071,630 I230T probably damaging Het
Zscan20 T C 4: 128,588,096 D591G possibly damaging Het
Other mutations in Stat6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Stat6 APN 10 127654932 missense probably damaging 1.00
IGL01785:Stat6 APN 10 127657227 missense probably damaging 1.00
IGL02939:Stat6 APN 10 127646940 missense probably benign 0.05
IGL03266:Stat6 APN 10 127657155 missense possibly damaging 0.88
IGL03412:Stat6 APN 10 127658205 missense probably benign 0.00
Stationary UTSW 10 127652222 missense possibly damaging 0.93
PIT4142001:Stat6 UTSW 10 127658230 missense possibly damaging 0.95
R0165:Stat6 UTSW 10 127657227 missense probably damaging 0.98
R0581:Stat6 UTSW 10 127648116 missense probably damaging 0.99
R0735:Stat6 UTSW 10 127658241 missense probably damaging 1.00
R1352:Stat6 UTSW 10 127650811 missense probably benign 0.32
R1457:Stat6 UTSW 10 127658245 missense probably damaging 0.98
R1538:Stat6 UTSW 10 127653256 missense probably damaging 1.00
R1696:Stat6 UTSW 10 127653049 missense probably damaging 1.00
R2016:Stat6 UTSW 10 127650796 missense probably damaging 1.00
R3236:Stat6 UTSW 10 127652222 missense possibly damaging 0.93
R3980:Stat6 UTSW 10 127655379 missense probably damaging 1.00
R4467:Stat6 UTSW 10 127651228 missense probably damaging 1.00
R5346:Stat6 UTSW 10 127652313 missense probably benign 0.44
R5481:Stat6 UTSW 10 127647826 splice site probably null
R5722:Stat6 UTSW 10 127658373 missense probably benign 0.00
R6036:Stat6 UTSW 10 127655444 missense possibly damaging 0.58
R6036:Stat6 UTSW 10 127655444 missense possibly damaging 0.58
R6244:Stat6 UTSW 10 127657712 splice site probably null
R6914:Stat6 UTSW 10 127651262 missense probably damaging 1.00
R6937:Stat6 UTSW 10 127658702 critical splice donor site probably null
R6942:Stat6 UTSW 10 127651262 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTAAACCCGAAGGATGGAGTTG -3'
(R):5'- CAGTGAAGGATCTGTGTGAGCACC -3'

Sequencing Primer
(F):5'- GACTGAGCTGTGTGAGGG -3'
(R):5'- AATCTGTATGCTCCCTGTCTG -3'
Posted On2014-02-11