Incidental Mutation 'R1333:Ctns'
ID156787
Institutional Source Beutler Lab
Gene Symbol Ctns
Ensembl Gene ENSMUSG00000005949
Gene Namecystinosis, nephropathic
Synonyms
MMRRC Submission 039398-MU
Accession Numbers

NCBI RefSeq: NM_031251; MGI: 1932872

Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1333 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73183596-73199042 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73184997 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 342 (T342I)
Ref Sequence ENSEMBL: ENSMUSP00000104116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006103] [ENSMUST00000040687] [ENSMUST00000108476] [ENSMUST00000108477]
Predicted Effect probably benign
Transcript: ENSMUST00000006103
AA Change: T342I

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000006103
Gene: ENSMUSG00000005949
AA Change: T342I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CTNS 140 171 6.43e-12 SMART
transmembrane domain 206 225 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
CTNS 279 310 1.47e-6 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040687
SMART Domains Protein: ENSMUSP00000047410
Gene: ENSMUSG00000040158

DomainStartEndE-ValueType
PDZ 27 113 1.1e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108476
AA Change: T342I

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104116
Gene: ENSMUSG00000005949
AA Change: T342I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CTNS 140 171 6.43e-12 SMART
transmembrane domain 206 225 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
CTNS 279 310 1.47e-6 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108477
SMART Domains Protein: ENSMUSP00000104117
Gene: ENSMUSG00000040158

DomainStartEndE-ValueType
PDB:3DJ1|B 1 98 6e-63 PDB
SCOP:d1fc6a3 24 86 3e-7 SMART
Blast:PDZ 27 87 6e-33 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150407
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 90.3%
Validation Efficiency 98% (41/42)
MGI Phenotype Strain: MGI:2388945
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane domain protein that functions to transport cystine out of lysosomes. Its activity is driven by the H+ electrochemical gradient of the lysosomal membrane. Mutations in this gene cause cystinosis, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased intracellular cystine, progressive accumulation of cystine crystals, occasional muscle impairment, reduced exploratory activity, osteoporosis, and lowered electroretinogram amplitude. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A G 8: 113,705,173 probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Amt A G 9: 108,301,097 D301G probably benign Het
Arhgef26 T C 3: 62,340,323 V276A probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Ccdc63 T C 5: 122,108,161 T566A probably benign Het
Cdk5rap1 A G 2: 154,360,654 S219P probably damaging Het
Col1a2 T A 6: 4,515,684 probably null Het
Dst G A 1: 34,228,347 E4957K probably damaging Het
Fam163b A G 2: 27,113,647 probably benign Het
Frem2 T C 3: 53,549,731 T2067A probably benign Het
Gm7353 C T 7: 3,109,066 noncoding transcript Het
Gm9791 T C 3: 34,005,076 noncoding transcript Het
Grik2 G T 10: 49,527,991 T258N probably damaging Het
Herc3 T C 6: 58,887,493 L704P probably damaging Het
Hjurp A C 1: 88,266,046 V380G probably damaging Het
Ikbkap C T 4: 56,770,969 probably benign Het
Lrrc56 A G 7: 141,198,264 probably benign Het
Mast3 G A 8: 70,781,294 P187S probably damaging Het
Mier2 A G 10: 79,545,157 V231A probably benign Het
Muc5b A G 7: 141,868,407 T4427A possibly damaging Het
Nox4 A G 7: 87,246,864 S7G possibly damaging Het
Obscn G C 11: 59,080,317 Q2457E probably damaging Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slc1a1 A G 19: 28,835,211 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stat6 G C 10: 127,651,225 R200S possibly damaging Het
Stxbp5l C A 16: 37,247,869 probably null Het
Tanc1 A G 2: 59,843,491 S1647G probably benign Het
Tmem132d T A 5: 127,784,859 M733L probably benign Het
Unc13d A G 11: 116,073,555 probably benign Het
Usp24 T C 4: 106,342,353 S165P possibly damaging Het
Vmn1r9 T C 6: 57,071,630 I230T probably damaging Het
Zscan20 T C 4: 128,588,096 D591G possibly damaging Het
Other mutations in Ctns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Ctns APN 11 73188722 missense possibly damaging 0.88
IGL02582:Ctns APN 11 73196652 missense probably benign 0.22
R0103:Ctns UTSW 11 73185311 missense probably damaging 1.00
R1125:Ctns UTSW 11 73187837 critical splice acceptor site probably null
R1422:Ctns UTSW 11 73185246 missense probably damaging 1.00
R1621:Ctns UTSW 11 73188472 missense possibly damaging 0.72
R2104:Ctns UTSW 11 73193081 missense probably benign 0.07
R2427:Ctns UTSW 11 73196686 missense probably damaging 1.00
R4096:Ctns UTSW 11 73186386 missense probably benign 0.11
R4946:Ctns UTSW 11 73196653 missense probably benign
R6220:Ctns UTSW 11 73193128 missense probably benign 0.00
R6307:Ctns UTSW 11 73191733 missense probably benign 0.26
R6744:Ctns UTSW 11 73185285 missense probably damaging 1.00
R7064:Ctns UTSW 11 73186392 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TTCTCTGGCCTTTGCTGGATACAAC -3'
(R):5'- GCGGTGTGCTCCTCGATTTTACAG -3'

Sequencing Primer
(F):5'- TGGATACAACCTTTCCTACCAGG -3'
(R):5'- TTACAATAATGGTGAGTCCGCCAG -3'
Posted On2014-02-11