Incidental Mutation 'R1335:Gm19965'
ID156830
Institutional Source Beutler Lab
Gene Symbol Gm19965
Ensembl Gene ENSMUSG00000094429
Gene Namepredicted gene, 19965
Synonyms
MMRRC Submission 039400-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R1335 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location116802983-116823410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116804619 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 64 (K64R)
Ref Sequence ENSEMBL: ENSMUSP00000137019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179777]
Predicted Effect possibly damaging
Transcript: ENSMUST00000179777
AA Change: K64R

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137019
Gene: ENSMUSG00000094429
AA Change: K64R

DomainStartEndE-ValueType
KRAB 8 68 1.5e-36 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amph G A 13: 19,142,028 V643M probably damaging Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cd209d T A 8: 3,872,027 D185V probably damaging Het
Cdc42bpb T C 12: 111,296,441 Y1484C probably damaging Het
Cdh9 T C 15: 16,850,792 V549A probably benign Het
Cmya5 C T 13: 93,041,535 V3604M possibly damaging Het
Eprs T A 1: 185,387,089 W489R probably damaging Het
Galnt14 T A 17: 73,526,290 I230F probably damaging Het
Gpr141 T G 13: 19,751,864 Y247S possibly damaging Het
Ivd A T 2: 118,869,442 H52L probably benign Het
Marc1 C T 1: 184,803,941 R98Q probably benign Het
Mcoln2 A G 3: 146,180,174 H260R probably benign Het
Mdga2 T C 12: 66,716,742 probably null Het
Ndrg3 T C 2: 156,946,008 probably benign Het
Olfr166 T C 16: 19,487,053 Y72H probably benign Het
Pcdhb17 A T 18: 37,486,234 N359I probably damaging Het
Phf24 G A 4: 42,934,657 V98I probably benign Het
Pkhd1 C A 1: 20,571,405 G270W probably damaging Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Prss51 T G 14: 64,096,171 probably null Het
Scarb2 C T 5: 92,451,346 probably null Het
Simc1 ACCA ACCANNNNNNNNNNNNNNNNNNCCA 13: 54,525,265 probably benign Het
Slco1c1 T A 6: 141,542,127 Y192N probably damaging Het
Smco2 T C 6: 146,862,087 probably benign Het
Snx13 A G 12: 35,132,124 D724G probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sytl4 GAAAAAA GAAAAA X: 133,961,126 probably benign Het
Tnr A G 1: 159,868,030 T508A probably benign Het
Vmn1r30 A G 6: 58,435,095 S251P probably damaging Het
Zdhhc16 T A 19: 41,940,634 probably null Het
Other mutations in Gm19965
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0993:Gm19965 UTSW 1 116821825 missense probably benign 0.04
R1016:Gm19965 UTSW 1 116821301 nonsense probably null
R1173:Gm19965 UTSW 1 116820820 splice site probably benign
R1175:Gm19965 UTSW 1 116820820 splice site probably benign
R1773:Gm19965 UTSW 1 116821259 nonsense probably null
R1802:Gm19965 UTSW 1 116820903 nonsense probably null
R2884:Gm19965 UTSW 1 116821583 missense probably benign 0.14
R3435:Gm19965 UTSW 1 116821623 missense possibly damaging 0.78
R4072:Gm19965 UTSW 1 116821071 missense probably benign 0.17
R4585:Gm19965 UTSW 1 116821778 missense probably benign 0.00
R4801:Gm19965 UTSW 1 116821896 missense probably benign
R4802:Gm19965 UTSW 1 116821896 missense probably benign
R5328:Gm19965 UTSW 1 116821418 missense possibly damaging 0.78
R5856:Gm19965 UTSW 1 116821849 missense probably benign
R5960:Gm19965 UTSW 1 116821471 missense possibly damaging 0.67
R6185:Gm19965 UTSW 1 116821273 missense possibly damaging 0.61
R6297:Gm19965 UTSW 1 116822680 missense possibly damaging 0.82
R6374:Gm19965 UTSW 1 116822291 missense probably benign 0.06
R6811:Gm19965 UTSW 1 116804079 missense probably damaging 1.00
R6860:Gm19965 UTSW 1 116820879 missense probably benign 0.19
R7076:Gm19965 UTSW 1 116821275 missense not run
Z1088:Gm19965 UTSW 1 116804600 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TTGGTCTGACATCCATTAATTGGCCTTT -3'
(R):5'- TGCCAGAACAAATCAGTCTCCATGTTTA -3'

Sequencing Primer
(F):5'- ATGTACTTTGCCTTCTAAAGTTGTC -3'
(R):5'- CAGGTCTAGATTACTCCT -3'
Posted On2014-02-11