Incidental Mutation 'R1335:Tnr'
ID156831
Institutional Source Beutler Lab
Gene Symbol Tnr
Ensembl Gene ENSMUSG00000015829
Gene Nametenascin R
SynonymsTN-R, janusin, restrictin, J1-tenascin
MMRRC Submission 039400-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1335 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location159523769-159931729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 159868030 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 508 (T508A)
Ref Sequence ENSEMBL: ENSMUSP00000141553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111669] [ENSMUST00000192069]
Predicted Effect probably benign
Transcript: ENSMUST00000111669
AA Change: T508A

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107298
Gene: ENSMUSG00000015829
AA Change: T508A

DomainStartEndE-ValueType
EGF_like 203 231 3.87e1 SMART
EGF_like 234 262 3.16e1 SMART
EGF_like 265 293 2.8e1 SMART
EGF 296 324 2.43e1 SMART
FN3 326 404 4.77e-8 SMART
FN3 415 493 3.1e-7 SMART
FN3 504 583 2.01e-6 SMART
FN3 594 675 1.98e-5 SMART
FN3 686 763 3.29e-11 SMART
FN3 774 851 3.32e-7 SMART
FN3 864 942 3.73e-10 SMART
FN3 953 1031 2.28e-5 SMART
FN3 1041 1118 8.56e-10 SMART
FBG 1133 1343 2.69e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192069
AA Change: T508A

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141553
Gene: ENSMUSG00000015829
AA Change: T508A

DomainStartEndE-ValueType
EGF_like 203 231 3.87e1 SMART
EGF_like 234 262 3.16e1 SMART
EGF_like 265 293 2.8e1 SMART
EGF 296 324 2.43e1 SMART
FN3 326 404 4.77e-8 SMART
FN3 415 493 3.1e-7 SMART
FN3 504 583 2.01e-6 SMART
FN3 594 675 1.98e-5 SMART
FN3 686 763 3.29e-11 SMART
FN3 774 851 3.32e-7 SMART
FN3 864 942 3.73e-10 SMART
FN3 953 1031 2.28e-5 SMART
FN3 1041 1118 8.56e-10 SMART
FBG 1133 1343 2.69e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192457
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The encoded protein is restricted to the central nervous system. The protein may play a role in neurite outgrowth, neural cell adhesion and modulation of sodium channel function. It is a constituent of perineuronal nets. [provided by RefSeq, Aug 2013]
PHENOTYPE: In spite of having decreased conduction velocity in the optic nerve and ultrastrucural alterations within the hippocampus, homozygous null mice are viable, fertile, and display normal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amph G A 13: 19,142,028 V643M probably damaging Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cd209d T A 8: 3,872,027 D185V probably damaging Het
Cdc42bpb T C 12: 111,296,441 Y1484C probably damaging Het
Cdh9 T C 15: 16,850,792 V549A probably benign Het
Cmya5 C T 13: 93,041,535 V3604M possibly damaging Het
Eprs T A 1: 185,387,089 W489R probably damaging Het
Galnt14 T A 17: 73,526,290 I230F probably damaging Het
Gm19965 A G 1: 116,804,619 K64R possibly damaging Het
Gpr141 T G 13: 19,751,864 Y247S possibly damaging Het
Ivd A T 2: 118,869,442 H52L probably benign Het
Marc1 C T 1: 184,803,941 R98Q probably benign Het
Mcoln2 A G 3: 146,180,174 H260R probably benign Het
Mdga2 T C 12: 66,716,742 probably null Het
Ndrg3 T C 2: 156,946,008 probably benign Het
Olfr166 T C 16: 19,487,053 Y72H probably benign Het
Pcdhb17 A T 18: 37,486,234 N359I probably damaging Het
Phf24 G A 4: 42,934,657 V98I probably benign Het
Pkhd1 C A 1: 20,571,405 G270W probably damaging Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Prss51 T G 14: 64,096,171 probably null Het
Scarb2 C T 5: 92,451,346 probably null Het
Simc1 ACCA ACCANNNNNNNNNNNNNNNNNNCCA 13: 54,525,265 probably benign Het
Slco1c1 T A 6: 141,542,127 Y192N probably damaging Het
Smco2 T C 6: 146,862,087 probably benign Het
Snx13 A G 12: 35,132,124 D724G probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sytl4 GAAAAAA GAAAAA X: 133,961,126 probably benign Het
Vmn1r30 A G 6: 58,435,095 S251P probably damaging Het
Zdhhc16 T A 19: 41,940,634 probably null Het
Other mutations in Tnr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Tnr APN 1 159861245 missense probably benign 0.00
IGL00905:Tnr APN 1 159852182 missense probably benign 0.06
IGL01396:Tnr APN 1 159897024 missense possibly damaging 0.91
IGL01550:Tnr APN 1 159874258 missense probably benign
IGL01803:Tnr APN 1 159868243 missense probably damaging 1.00
IGL01845:Tnr APN 1 159868006 unclassified probably benign
IGL01983:Tnr APN 1 159863779 missense probably benign 0.00
IGL01985:Tnr APN 1 159919037 missense possibly damaging 0.70
IGL02210:Tnr APN 1 159852101 missense probably benign 0.44
IGL02486:Tnr APN 1 159852094 unclassified probably null
IGL03210:Tnr APN 1 159888310 missense probably benign 0.00
R0002:Tnr UTSW 1 159874200 missense probably damaging 1.00
R0002:Tnr UTSW 1 159874200 missense probably damaging 1.00
R0009:Tnr UTSW 1 159852416 missense probably damaging 1.00
R0042:Tnr UTSW 1 159887025 missense probably benign 0.01
R0594:Tnr UTSW 1 159850335 missense probably benign
R0617:Tnr UTSW 1 159868103 missense probably damaging 1.00
R0637:Tnr UTSW 1 159850335 missense possibly damaging 0.60
R0682:Tnr UTSW 1 159852307 nonsense probably null
R1171:Tnr UTSW 1 159858210 missense probably damaging 0.97
R1185:Tnr UTSW 1 159852286 missense probably benign
R1185:Tnr UTSW 1 159852286 missense probably benign
R1185:Tnr UTSW 1 159852286 missense probably benign
R1540:Tnr UTSW 1 159850105 missense probably damaging 0.99
R1697:Tnr UTSW 1 159852030 missense probably benign 0.00
R1938:Tnr UTSW 1 159895037 nonsense probably null
R1941:Tnr UTSW 1 159850134 missense possibly damaging 0.92
R2021:Tnr UTSW 1 159852022 missense probably benign
R2022:Tnr UTSW 1 159852022 missense probably benign
R2051:Tnr UTSW 1 159892033 missense probably benign
R2157:Tnr UTSW 1 159858270 missense probably damaging 0.98
R2319:Tnr UTSW 1 159850048 start codon destroyed probably null 1.00
R2936:Tnr UTSW 1 159888362 missense probably damaging 0.96
R3015:Tnr UTSW 1 159888259 missense probably benign 0.00
R3417:Tnr UTSW 1 159895042 missense probably benign 0.00
R3739:Tnr UTSW 1 159923413 missense possibly damaging 0.78
R3977:Tnr UTSW 1 159892023 missense probably benign
R4232:Tnr UTSW 1 159886215 missense possibly damaging 0.55
R4478:Tnr UTSW 1 159884756 splice site probably null
R4774:Tnr UTSW 1 159897066 missense probably damaging 1.00
R4829:Tnr UTSW 1 159858404 missense probably benign 0.24
R4837:Tnr UTSW 1 159684788 intron probably benign
R5111:Tnr UTSW 1 159886228 missense probably benign 0.04
R5224:Tnr UTSW 1 159923315 missense probably damaging 1.00
R5249:Tnr UTSW 1 159684656 intron probably benign
R5730:Tnr UTSW 1 159888322 missense probably benign 0.02
R5807:Tnr UTSW 1 159886930 missense possibly damaging 0.95
R5832:Tnr UTSW 1 159886122 missense probably benign 0.15
R5927:Tnr UTSW 1 159912766 missense probably damaging 1.00
R6049:Tnr UTSW 1 159912754 missense probably damaging 1.00
R6056:Tnr UTSW 1 159886909 missense probably damaging 0.99
R6063:Tnr UTSW 1 159912684 missense probably benign 0.00
R6141:Tnr UTSW 1 159887122 missense probably benign
R6218:Tnr UTSW 1 159888314 missense possibly damaging 0.94
R6275:Tnr UTSW 1 159861270 missense probably damaging 0.99
R6543:Tnr UTSW 1 159924107 missense probably damaging 1.00
R6626:Tnr UTSW 1 159850252 missense probably damaging 1.00
X0011:Tnr UTSW 1 159889338 missense probably benign 0.02
X0028:Tnr UTSW 1 159874114 missense probably damaging 1.00
Z1088:Tnr UTSW 1 159895095 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TGCCCAGACCATGAAATGCCAG -3'
(R):5'- AACATCGTCGTGTTGTCTCCCAG -3'

Sequencing Primer
(F):5'- CATGAAATGCCAGTGCCTG -3'
(R):5'- CAGTCTCACCTGTTGTAAATTGG -3'
Posted On2014-02-11