Incidental Mutation 'R1335:Marc1'
ID156832
Institutional Source Beutler Lab
Gene Symbol Marc1
Ensembl Gene ENSMUSG00000026621
Gene Namemitochondrial amidoxime reducing component 1
Synonyms1300013F15Rik, Mosc1
MMRRC Submission 039400-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1335 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location184786767-184811313 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 184803941 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 98 (R98Q)
Ref Sequence ENSEMBL: ENSMUSP00000139716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048462] [ENSMUST00000110992] [ENSMUST00000189492]
Predicted Effect probably benign
Transcript: ENSMUST00000048462
AA Change: R203Q

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000035804
Gene: ENSMUSG00000026621
AA Change: R203Q

DomainStartEndE-ValueType
transmembrane domain 25 44 N/A INTRINSIC
low complexity region 45 54 N/A INTRINSIC
Pfam:MOSC_N 58 179 1e-39 PFAM
Pfam:MOSC 195 337 3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110992
AA Change: G202R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106620
Gene: ENSMUSG00000026621
AA Change: G202R

DomainStartEndE-ValueType
transmembrane domain 25 44 N/A INTRINSIC
low complexity region 45 54 N/A INTRINSIC
Pfam:MOSC_N 58 179 1.7e-40 PFAM
Pfam:MOSC 205 338 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189492
AA Change: R98Q

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000139716
Gene: ENSMUSG00000026621
AA Change: R98Q

DomainStartEndE-ValueType
Pfam:MOSC_N 1 74 4.2e-15 PFAM
Pfam:MOSC 90 232 3.5e-28 PFAM
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amph G A 13: 19,142,028 V643M probably damaging Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cd209d T A 8: 3,872,027 D185V probably damaging Het
Cdc42bpb T C 12: 111,296,441 Y1484C probably damaging Het
Cdh9 T C 15: 16,850,792 V549A probably benign Het
Cmya5 C T 13: 93,041,535 V3604M possibly damaging Het
Eprs T A 1: 185,387,089 W489R probably damaging Het
Galnt14 T A 17: 73,526,290 I230F probably damaging Het
Gm19965 A G 1: 116,804,619 K64R possibly damaging Het
Gpr141 T G 13: 19,751,864 Y247S possibly damaging Het
Ivd A T 2: 118,869,442 H52L probably benign Het
Mcoln2 A G 3: 146,180,174 H260R probably benign Het
Mdga2 T C 12: 66,716,742 probably null Het
Ndrg3 T C 2: 156,946,008 probably benign Het
Olfr166 T C 16: 19,487,053 Y72H probably benign Het
Pcdhb17 A T 18: 37,486,234 N359I probably damaging Het
Phf24 G A 4: 42,934,657 V98I probably benign Het
Pkhd1 C A 1: 20,571,405 G270W probably damaging Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Prss51 T G 14: 64,096,171 probably null Het
Scarb2 C T 5: 92,451,346 probably null Het
Simc1 ACCA ACCANNNNNNNNNNNNNNNNNNCCA 13: 54,525,265 probably benign Het
Slco1c1 T A 6: 141,542,127 Y192N probably damaging Het
Smco2 T C 6: 146,862,087 probably benign Het
Snx13 A G 12: 35,132,124 D724G probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sytl4 GAAAAAA GAAAAA X: 133,961,126 probably benign Het
Tnr A G 1: 159,868,030 T508A probably benign Het
Vmn1r30 A G 6: 58,435,095 S251P probably damaging Het
Zdhhc16 T A 19: 41,940,634 probably null Het
Other mutations in Marc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01454:Marc1 APN 1 184807180 missense probably damaging 1.00
IGL01985:Marc1 APN 1 184787734 missense probably damaging 1.00
E0370:Marc1 UTSW 1 184795228 splice site probably benign
PIT1430001:Marc1 UTSW 1 184807049 missense probably benign
R1538:Marc1 UTSW 1 184802002 missense probably damaging 0.99
R2139:Marc1 UTSW 1 184795435 missense probably benign 0.17
R4591:Marc1 UTSW 1 184807168 missense probably benign 0.10
R5642:Marc1 UTSW 1 184810919 missense probably damaging 1.00
R6251:Marc1 UTSW 1 184795451 missense probably damaging 1.00
R6370:Marc1 UTSW 1 184795492 missense probably damaging 1.00
R7095:Marc1 UTSW 1 184795240 missense not run
Predicted Primers PCR Primer
(F):5'- TTGGCCCTCTACTTAGAAGCCTGG -3'
(R):5'- AGTTGGATGCAGCTTTCCGACC -3'

Sequencing Primer
(F):5'- CCAGGCTGTGAGCACAAG -3'
(R):5'- GTGTTAACCATACTCAGAGCATC -3'
Posted On2014-02-11