Incidental Mutation 'R1335:Ivd'
ID156834
Institutional Source Beutler Lab
Gene Symbol Ivd
Ensembl Gene ENSMUSG00000027332
Gene Nameisovaleryl coenzyme A dehydrogenase
Synonyms
MMRRC Submission 039400-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1335 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118861954-118882909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118869442 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 52 (H52L)
Ref Sequence ENSEMBL: ENSMUSP00000028807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028807]
Predicted Effect probably benign
Transcript: ENSMUST00000028807
AA Change: H52L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000028807
Gene: ENSMUSG00000027332
AA Change: H52L

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 44 158 9.4e-40 PFAM
Pfam:Acyl-CoA_dh_M 162 259 8.1e-31 PFAM
Pfam:Acyl-CoA_dh_1 271 419 2e-42 PFAM
Pfam:Acyl-CoA_dh_2 286 409 6.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150162
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amph G A 13: 19,142,028 V643M probably damaging Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cd209d T A 8: 3,872,027 D185V probably damaging Het
Cdc42bpb T C 12: 111,296,441 Y1484C probably damaging Het
Cdh9 T C 15: 16,850,792 V549A probably benign Het
Cmya5 C T 13: 93,041,535 V3604M possibly damaging Het
Eprs T A 1: 185,387,089 W489R probably damaging Het
Galnt14 T A 17: 73,526,290 I230F probably damaging Het
Gm19965 A G 1: 116,804,619 K64R possibly damaging Het
Gpr141 T G 13: 19,751,864 Y247S possibly damaging Het
Marc1 C T 1: 184,803,941 R98Q probably benign Het
Mcoln2 A G 3: 146,180,174 H260R probably benign Het
Mdga2 T C 12: 66,716,742 probably null Het
Ndrg3 T C 2: 156,946,008 probably benign Het
Olfr166 T C 16: 19,487,053 Y72H probably benign Het
Pcdhb17 A T 18: 37,486,234 N359I probably damaging Het
Phf24 G A 4: 42,934,657 V98I probably benign Het
Pkhd1 C A 1: 20,571,405 G270W probably damaging Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Prss51 T G 14: 64,096,171 probably null Het
Scarb2 C T 5: 92,451,346 probably null Het
Simc1 ACCA ACCANNNNNNNNNNNNNNNNNNCCA 13: 54,525,265 probably benign Het
Slco1c1 T A 6: 141,542,127 Y192N probably damaging Het
Smco2 T C 6: 146,862,087 probably benign Het
Snx13 A G 12: 35,132,124 D724G probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sytl4 GAAAAAA GAAAAA X: 133,961,126 probably benign Het
Tnr A G 1: 159,868,030 T508A probably benign Het
Vmn1r30 A G 6: 58,435,095 S251P probably damaging Het
Zdhhc16 T A 19: 41,940,634 probably null Het
Other mutations in Ivd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Ivd APN 2 118876902 missense probably benign 0.06
IGL01122:Ivd APN 2 118876880 splice site probably benign
IGL01634:Ivd APN 2 118876382 missense probably damaging 1.00
IGL02178:Ivd APN 2 118871434 missense probably benign 0.00
IGL02478:Ivd APN 2 118862091 missense probably benign 0.21
IGL03104:Ivd APN 2 118872903 missense probably benign 0.01
R1823:Ivd UTSW 2 118862034 missense probably benign 0.05
R2008:Ivd UTSW 2 118871500 missense probably benign 0.00
R3162:Ivd UTSW 2 118862169 critical splice donor site probably null
R3162:Ivd UTSW 2 118862169 critical splice donor site probably null
R5011:Ivd UTSW 2 118880465 missense probably damaging 1.00
R5013:Ivd UTSW 2 118880465 missense probably damaging 1.00
R5946:Ivd UTSW 2 118876889 missense possibly damaging 0.49
R6810:Ivd UTSW 2 118869761 missense probably benign
R7055:Ivd UTSW 2 118873249 missense probably damaging 0.99
R7131:Ivd UTSW 2 118869774 missense probably damaging 1.00
R7173:Ivd UTSW 2 118871389 missense probably damaging 1.00
R7302:Ivd UTSW 2 118871504 missense probably benign 0.04
R7490:Ivd UTSW 2 118876892 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTAAGCCTCAACCTGATGCTGTG -3'
(R):5'- CAGAACTCCTGCCAACAGAAGAGTG -3'

Sequencing Primer
(F):5'- CTGTGTGGTGAGAGTACCC -3'
(R):5'- AAGGCAGCTAGTCACTTGTG -3'
Posted On2014-02-11