Incidental Mutation 'R1335:Mcoln2'
ID156837
Institutional Source Beutler Lab
Gene Symbol Mcoln2
Ensembl Gene ENSMUSG00000011008
Gene Namemucolipin 2
Synonymsmucolipidin 2, TRPML2, 3300002C04Rik
MMRRC Submission 039400-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R1335 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location146149833-146195513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146180174 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 260 (H260R)
Ref Sequence ENSEMBL: ENSMUSP00000096125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011152] [ENSMUST00000098524]
Predicted Effect probably benign
Transcript: ENSMUST00000011152
AA Change: H288R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000011152
Gene: ENSMUSG00000011008
AA Change: H288R

DomainStartEndE-ValueType
transmembrane domain 292 314 N/A INTRINSIC
transmembrane domain 340 362 N/A INTRINSIC
Pfam:PKD_channel 370 513 5.8e-12 PFAM
low complexity region 546 558 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098524
AA Change: H260R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096125
Gene: ENSMUSG00000011008
AA Change: H260R

DomainStartEndE-ValueType
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 312 334 N/A INTRINSIC
Pfam:PKD_channel 343 485 6.9e-11 PFAM
low complexity region 518 530 N/A INTRINSIC
Meta Mutation Damage Score 0.1516 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mucolipins constitute a family of cation channel proteins with homology to the transient receptor potential superfamily. In mammals, the mucolipin family includes 3 members, MCOLN1 (MIM 605248), MCOLN2, and MCOLN3 (MIM 607400), that exhibit a common 6-membrane-spanning topology. Homologs of mammalian mucolipins exist in Drosophila and C. elegans. Mutations in the human MCOLN1 gene cause mucolipodosis IV (MIM 262650) (Karacsonyi et al., 2007 [PubMed 17662026]).[supplied by OMIM, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced chemokine production in bone marrow-derived macrophages and impaired recruitment of peripheral macrophages in response to i.p. injections of LPS or live bacteria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amph G A 13: 19,142,028 V643M probably damaging Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cd209d T A 8: 3,872,027 D185V probably damaging Het
Cdc42bpb T C 12: 111,296,441 Y1484C probably damaging Het
Cdh9 T C 15: 16,850,792 V549A probably benign Het
Cmya5 C T 13: 93,041,535 V3604M possibly damaging Het
Eprs T A 1: 185,387,089 W489R probably damaging Het
Galnt14 T A 17: 73,526,290 I230F probably damaging Het
Gm19965 A G 1: 116,804,619 K64R possibly damaging Het
Gpr141 T G 13: 19,751,864 Y247S possibly damaging Het
Ivd A T 2: 118,869,442 H52L probably benign Het
Marc1 C T 1: 184,803,941 R98Q probably benign Het
Mdga2 T C 12: 66,716,742 probably null Het
Ndrg3 T C 2: 156,946,008 probably benign Het
Olfr166 T C 16: 19,487,053 Y72H probably benign Het
Pcdhb17 A T 18: 37,486,234 N359I probably damaging Het
Phf24 G A 4: 42,934,657 V98I probably benign Het
Pkhd1 C A 1: 20,571,405 G270W probably damaging Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Prss51 T G 14: 64,096,171 probably null Het
Scarb2 C T 5: 92,451,346 probably null Het
Simc1 ACCA ACCANNNNNNNNNNNNNNNNNNCCA 13: 54,525,265 probably benign Het
Slco1c1 T A 6: 141,542,127 Y192N probably damaging Het
Smco2 T C 6: 146,862,087 probably benign Het
Snx13 A G 12: 35,132,124 D724G probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sytl4 GAAAAAA GAAAAA X: 133,961,126 probably benign Het
Tnr A G 1: 159,868,030 T508A probably benign Het
Vmn1r30 A G 6: 58,435,095 S251P probably damaging Het
Zdhhc16 T A 19: 41,940,634 probably null Het
Other mutations in Mcoln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Mcoln2 APN 3 146163527 splice site probably benign
IGL01370:Mcoln2 APN 3 146181830 missense possibly damaging 0.71
IGL01479:Mcoln2 APN 3 146175652 splice site probably benign
IGL02629:Mcoln2 APN 3 146170044 missense probably benign 0.28
R0010:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0010:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0039:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0039:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0044:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0044:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0109:Mcoln2 UTSW 3 146175718 missense probably damaging 1.00
R0458:Mcoln2 UTSW 3 146150013 unclassified probably benign
R1440:Mcoln2 UTSW 3 146190382 nonsense probably null
R1452:Mcoln2 UTSW 3 146181814 missense possibly damaging 0.92
R1459:Mcoln2 UTSW 3 146192224 splice site probably null
R1510:Mcoln2 UTSW 3 146176610 missense probably benign 0.02
R1603:Mcoln2 UTSW 3 146180222 missense probably damaging 1.00
R1652:Mcoln2 UTSW 3 146163635 missense possibly damaging 0.48
R1718:Mcoln2 UTSW 3 146190474 splice site probably benign
R1826:Mcoln2 UTSW 3 146175472 missense possibly damaging 0.69
R4319:Mcoln2 UTSW 3 146150011 splice site probably null
R4719:Mcoln2 UTSW 3 146175713 missense probably benign 0.00
R4939:Mcoln2 UTSW 3 146192241 missense probably benign 0.07
R5475:Mcoln2 UTSW 3 146183786 missense probably damaging 1.00
R5718:Mcoln2 UTSW 3 146181826 missense probably damaging 1.00
R5906:Mcoln2 UTSW 3 146183741 missense probably damaging 1.00
R6911:Mcoln2 UTSW 3 146192256 missense probably damaging 1.00
R6963:Mcoln2 UTSW 3 146172035 missense probably damaging 1.00
R7142:Mcoln2 UTSW 3 146183569 critical splice donor site unknown
Predicted Primers PCR Primer
(F):5'- TTGCTGTGTGAAGCAACGCAGG -3'
(R):5'- CAAATGCAGGCTGTTGGCTGAG -3'

Sequencing Primer
(F):5'- TCTTCTGAATGGAGCCCAACG -3'
(R):5'- TGGCTGAGTGGAGGGAGAC -3'
Posted On2014-02-11