Incidental Mutation 'R1335:Phf24'
ID156838
Institutional Source Beutler Lab
Gene Symbol Phf24
Ensembl Gene ENSMUSG00000036062
Gene NamePHD finger protein 24
SynonymsN28178, GINIP
MMRRC Submission 039400-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1335 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location42916660-42944752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42934657 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 98 (V98I)
Ref Sequence ENSEMBL: ENSMUSP00000103610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069184] [ENSMUST00000107975] [ENSMUST00000107976] [ENSMUST00000124380] [ENSMUST00000132173] [ENSMUST00000139100]
Predicted Effect probably benign
Transcript: ENSMUST00000069184
AA Change: V98I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000071011
Gene: ENSMUSG00000036062
AA Change: V98I

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
PDB:1WIL|A 86 161 9e-49 PDB
SCOP:d1el4a_ 158 282 3e-4 SMART
low complexity region 308 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107975
AA Change: V135I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103609
Gene: ENSMUSG00000036062
AA Change: V135I

DomainStartEndE-ValueType
low complexity region 51 64 N/A INTRINSIC
Pfam:Zf_RING 126 198 2e-41 PFAM
low complexity region 243 254 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
low complexity region 345 356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107976
AA Change: V98I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000103610
Gene: ENSMUSG00000036062
AA Change: V98I

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
PDB:1WIL|A 86 161 9e-49 PDB
SCOP:d1el4a_ 158 282 3e-4 SMART
low complexity region 308 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124380
Predicted Effect probably benign
Transcript: ENSMUST00000131234
Predicted Effect probably benign
Transcript: ENSMUST00000132173
SMART Domains Protein: ENSMUSP00000138443
Gene: ENSMUSG00000036062

DomainStartEndE-ValueType
low complexity region 51 64 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000138425
AA Change: V35I
SMART Domains Protein: ENSMUSP00000115816
Gene: ENSMUSG00000036062
AA Change: V35I

DomainStartEndE-ValueType
Pfam:Zf_RING 27 74 1.4e-24 PFAM
SCOP:d1el4a_ 80 204 2e-4 SMART
low complexity region 230 241 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151824
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele develop a selective and prolonged mechanical hypersensitivity in models of inflammation and neuropathy and show impaired baclofen-mediated analgesia following nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amph G A 13: 19,142,028 V643M probably damaging Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cd209d T A 8: 3,872,027 D185V probably damaging Het
Cdc42bpb T C 12: 111,296,441 Y1484C probably damaging Het
Cdh9 T C 15: 16,850,792 V549A probably benign Het
Cmya5 C T 13: 93,041,535 V3604M possibly damaging Het
Eprs T A 1: 185,387,089 W489R probably damaging Het
Galnt14 T A 17: 73,526,290 I230F probably damaging Het
Gm19965 A G 1: 116,804,619 K64R possibly damaging Het
Gpr141 T G 13: 19,751,864 Y247S possibly damaging Het
Ivd A T 2: 118,869,442 H52L probably benign Het
Marc1 C T 1: 184,803,941 R98Q probably benign Het
Mcoln2 A G 3: 146,180,174 H260R probably benign Het
Mdga2 T C 12: 66,716,742 probably null Het
Ndrg3 T C 2: 156,946,008 probably benign Het
Olfr166 T C 16: 19,487,053 Y72H probably benign Het
Pcdhb17 A T 18: 37,486,234 N359I probably damaging Het
Pkhd1 C A 1: 20,571,405 G270W probably damaging Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Prss51 T G 14: 64,096,171 probably null Het
Scarb2 C T 5: 92,451,346 probably null Het
Simc1 ACCA ACCANNNNNNNNNNNNNNNNNNCCA 13: 54,525,265 probably benign Het
Slco1c1 T A 6: 141,542,127 Y192N probably damaging Het
Smco2 T C 6: 146,862,087 probably benign Het
Snx13 A G 12: 35,132,124 D724G probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sytl4 GAAAAAA GAAAAA X: 133,961,126 probably benign Het
Tnr A G 1: 159,868,030 T508A probably benign Het
Vmn1r30 A G 6: 58,435,095 S251P probably damaging Het
Zdhhc16 T A 19: 41,940,634 probably null Het
Other mutations in Phf24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Phf24 APN 4 42933905 missense possibly damaging 0.76
IGL00907:Phf24 APN 4 42938667 missense probably benign 0.01
R0110:Phf24 UTSW 4 42933761 missense possibly damaging 0.81
R0355:Phf24 UTSW 4 42933891 missense probably damaging 1.00
R0450:Phf24 UTSW 4 42933761 missense possibly damaging 0.81
R0469:Phf24 UTSW 4 42933761 missense possibly damaging 0.81
R1447:Phf24 UTSW 4 42938232 nonsense probably null
R1824:Phf24 UTSW 4 42934661 missense probably damaging 1.00
R1918:Phf24 UTSW 4 42938165 unclassified probably benign
R2075:Phf24 UTSW 4 42939507 missense possibly damaging 0.95
R3111:Phf24 UTSW 4 42938316 missense probably benign 0.00
R3548:Phf24 UTSW 4 42937879 nonsense probably null
R4422:Phf24 UTSW 4 42934817 missense probably damaging 1.00
R4803:Phf24 UTSW 4 42933731 missense probably damaging 1.00
R5287:Phf24 UTSW 4 42933831 unclassified probably null
R5403:Phf24 UTSW 4 42933831 unclassified probably null
R6025:Phf24 UTSW 4 42938780 splice site probably null
R6309:Phf24 UTSW 4 42933960 missense probably damaging 1.00
X0026:Phf24 UTSW 4 42939084 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTAACAGAGCCCTAAGCAGCTTCC -3'
(R):5'- ATACTGCACCTCTAGCTCCAGGAC -3'

Sequencing Primer
(F):5'- AAGCAGCTTCCTAGTGCTCG -3'
(R):5'- GGATGAACACCGAGTTTTCC -3'
Posted On2014-02-11