Incidental Mutation 'R1335:Scarb2'
ID156839
Institutional Source Beutler Lab
Gene Symbol Scarb2
Ensembl Gene ENSMUSG00000029426
Gene Namescavenger receptor class B, member 2
SynonymsLIMP-2, 9330185J12Rik, Cd36l2, LIMP II, LGP85
MMRRC Submission 039400-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1335 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location92441314-92506833 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 92451346 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031377]
Predicted Effect probably null
Transcript: ENSMUST00000031377
SMART Domains Protein: ENSMUSP00000031377
Gene: ENSMUSG00000029426

DomainStartEndE-ValueType
Pfam:CD36 11 457 6.8e-154 PFAM
Meta Mutation Damage Score 0.662 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: This gene encodes a CD36-like type III transmembrane glycoprotein that localizes to the lysosomal membrane. Mice lacking the encoded protein exhibit an increased postnatal mortality caused by an obstruction of the ureteropelvic junction, deafness, peripheral demyelinating neuropathy and tubular proteinuria. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous mutation of this gene results in renal dysfunction, progressive deafness, and progressive demylination of the peripheral nerves. Mutant animals show a 2-fold increased water consumption along with increased urine volume, and develop an enlarged, ball-like trunk with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amph G A 13: 19,142,028 V643M probably damaging Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cd209d T A 8: 3,872,027 D185V probably damaging Het
Cdc42bpb T C 12: 111,296,441 Y1484C probably damaging Het
Cdh9 T C 15: 16,850,792 V549A probably benign Het
Cmya5 C T 13: 93,041,535 V3604M possibly damaging Het
Eprs T A 1: 185,387,089 W489R probably damaging Het
Galnt14 T A 17: 73,526,290 I230F probably damaging Het
Gm19965 A G 1: 116,804,619 K64R possibly damaging Het
Gpr141 T G 13: 19,751,864 Y247S possibly damaging Het
Ivd A T 2: 118,869,442 H52L probably benign Het
Marc1 C T 1: 184,803,941 R98Q probably benign Het
Mcoln2 A G 3: 146,180,174 H260R probably benign Het
Mdga2 T C 12: 66,716,742 probably null Het
Ndrg3 T C 2: 156,946,008 probably benign Het
Olfr166 T C 16: 19,487,053 Y72H probably benign Het
Pcdhb17 A T 18: 37,486,234 N359I probably damaging Het
Phf24 G A 4: 42,934,657 V98I probably benign Het
Pkhd1 C A 1: 20,571,405 G270W probably damaging Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Prss51 T G 14: 64,096,171 probably null Het
Simc1 ACCA ACCANNNNNNNNNNNNNNNNNNCCA 13: 54,525,265 probably benign Het
Slco1c1 T A 6: 141,542,127 Y192N probably damaging Het
Smco2 T C 6: 146,862,087 probably benign Het
Snx13 A G 12: 35,132,124 D724G probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sytl4 GAAAAAA GAAAAA X: 133,961,126 probably benign Het
Tnr A G 1: 159,868,030 T508A probably benign Het
Vmn1r30 A G 6: 58,435,095 S251P probably damaging Het
Zdhhc16 T A 19: 41,940,634 probably null Het
Other mutations in Scarb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Scarb2 APN 5 92446344 missense probably damaging 1.00
IGL01743:Scarb2 APN 5 92460803 missense probably benign 0.01
IGL02182:Scarb2 APN 5 92454054 missense probably damaging 1.00
IGL02602:Scarb2 APN 5 92448556 missense probably benign 0.12
IGL03260:Scarb2 APN 5 92446437 missense probably damaging 1.00
scarab UTSW 5 92451346 critical splice donor site probably null
R1332:Scarb2 UTSW 5 92451346 critical splice donor site probably null
R1526:Scarb2 UTSW 5 92446341 missense possibly damaging 0.50
R1748:Scarb2 UTSW 5 92460836 missense probably damaging 1.00
R1779:Scarb2 UTSW 5 92448557 missense probably benign 0.13
R1928:Scarb2 UTSW 5 92444266 missense possibly damaging 0.50
R4952:Scarb2 UTSW 5 92454777 missense probably damaging 0.97
R5702:Scarb2 UTSW 5 92451396 missense probably damaging 1.00
R6868:Scarb2 UTSW 5 92485309 missense probably benign 0.05
R7000:Scarb2 UTSW 5 92454075 missense probably benign 0.00
X0067:Scarb2 UTSW 5 92460857 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGTTATGTGGGTACAGCCTCAGC -3'
(R):5'- GTGAACCAATTTTGCGGTCAGGAC -3'

Sequencing Primer
(F):5'- ctgagccacatccctaatcc -3'
(R):5'- AGGACCTGTGTGTTCTTCTTAGAC -3'
Posted On2014-02-11