Incidental Mutation 'R1335:Vmn1r30'
ID156840
Institutional Source Beutler Lab
Gene Symbol Vmn1r30
Ensembl Gene ENSMUSG00000095670
Gene Namevomeronasal 1 receptor 30
SynonymsV1rc9, V1rc22
MMRRC Submission 039400-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1335 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location58434159-58443385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58435095 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 251 (S251P)
Ref Sequence ENSEMBL: ENSMUSP00000154098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078890] [ENSMUST00000226334] [ENSMUST00000227466] [ENSMUST00000228577] [ENSMUST00000228635]
Predicted Effect probably damaging
Transcript: ENSMUST00000078890
AA Change: S251P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000087336
Gene: ENSMUSG00000095670
AA Change: S251P

DomainStartEndE-ValueType
Pfam:V1R 29 293 4.8e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203463
Predicted Effect probably damaging
Transcript: ENSMUST00000226334
AA Change: S251P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000227466
AA Change: S251P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000228577
AA Change: S251P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000228635
AA Change: S251P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.0352 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amph G A 13: 19,142,028 V643M probably damaging Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cd209d T A 8: 3,872,027 D185V probably damaging Het
Cdc42bpb T C 12: 111,296,441 Y1484C probably damaging Het
Cdh9 T C 15: 16,850,792 V549A probably benign Het
Cmya5 C T 13: 93,041,535 V3604M possibly damaging Het
Eprs T A 1: 185,387,089 W489R probably damaging Het
Galnt14 T A 17: 73,526,290 I230F probably damaging Het
Gm19965 A G 1: 116,804,619 K64R possibly damaging Het
Gpr141 T G 13: 19,751,864 Y247S possibly damaging Het
Ivd A T 2: 118,869,442 H52L probably benign Het
Marc1 C T 1: 184,803,941 R98Q probably benign Het
Mcoln2 A G 3: 146,180,174 H260R probably benign Het
Mdga2 T C 12: 66,716,742 probably null Het
Ndrg3 T C 2: 156,946,008 probably benign Het
Olfr166 T C 16: 19,487,053 Y72H probably benign Het
Pcdhb17 A T 18: 37,486,234 N359I probably damaging Het
Phf24 G A 4: 42,934,657 V98I probably benign Het
Pkhd1 C A 1: 20,571,405 G270W probably damaging Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Prss51 T G 14: 64,096,171 probably null Het
Scarb2 C T 5: 92,451,346 probably null Het
Simc1 ACCA ACCANNNNNNNNNNNNNNNNNNCCA 13: 54,525,265 probably benign Het
Slco1c1 T A 6: 141,542,127 Y192N probably damaging Het
Smco2 T C 6: 146,862,087 probably benign Het
Snx13 A G 12: 35,132,124 D724G probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sytl4 GAAAAAA GAAAAA X: 133,961,126 probably benign Het
Tnr A G 1: 159,868,030 T508A probably benign Het
Zdhhc16 T A 19: 41,940,634 probably null Het
Other mutations in Vmn1r30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01657:Vmn1r30 APN 6 58435634 missense probably benign 0.01
IGL02432:Vmn1r30 APN 6 58435670 missense probably benign 0.04
IGL02627:Vmn1r30 APN 6 58435761 missense probably benign 0.08
IGL02870:Vmn1r30 APN 6 58435370 missense probably benign 0.01
R0360:Vmn1r30 UTSW 6 58435277 missense probably benign 0.03
R1071:Vmn1r30 UTSW 6 58435828 missense possibly damaging 0.93
R1888:Vmn1r30 UTSW 6 58435490 missense possibly damaging 0.93
R1888:Vmn1r30 UTSW 6 58435490 missense possibly damaging 0.93
R2483:Vmn1r30 UTSW 6 58435452 missense probably benign 0.02
R3622:Vmn1r30 UTSW 6 58435452 missense probably benign 0.02
R3623:Vmn1r30 UTSW 6 58435452 missense probably benign 0.02
R3624:Vmn1r30 UTSW 6 58435452 missense probably benign 0.02
R3744:Vmn1r30 UTSW 6 58435819 nonsense probably null
R3762:Vmn1r30 UTSW 6 58435293 missense probably benign 0.20
R4483:Vmn1r30 UTSW 6 58435133 missense probably damaging 1.00
R4484:Vmn1r30 UTSW 6 58435133 missense probably damaging 1.00
R5160:Vmn1r30 UTSW 6 58435383 missense probably benign 0.03
R5408:Vmn1r30 UTSW 6 58435044 missense probably benign 0.03
R5461:Vmn1r30 UTSW 6 58435774 nonsense probably null
R5888:Vmn1r30 UTSW 6 58435565 missense possibly damaging 0.94
R7068:Vmn1r30 UTSW 6 58435010 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGAAGAATCTCACTTTGCCCCTTGAC -3'
(R):5'- ATTATCTTGTTCAGACACCAGAGGCAC -3'

Sequencing Primer
(F):5'- caccagaagagggcatcag -3'
(R):5'- CTTCATAGCATCAGGCACCT -3'
Posted On2014-02-11