Incidental Mutation 'R1335:Bid'
ID156841
Institutional Source Beutler Lab
Gene Symbol Bid
Ensembl Gene ENSMUSG00000004446
Gene NameBH3 interacting domain death agonist
Synonyms
MMRRC Submission 039400-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R1335 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location120891930-120916853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120897255 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 110 (A110T)
Ref Sequence ENSEMBL: ENSMUSP00000125731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004560] [ENSMUST00000009256] [ENSMUST00000145948] [ENSMUST00000160684]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004560
AA Change: A110T

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000004560
Gene: ENSMUSG00000004446
AA Change: A110T

DomainStartEndE-ValueType
Pfam:BID 3 192 2.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000009256
SMART Domains Protein: ENSMUSP00000009256
Gene: ENSMUSG00000009112

DomainStartEndE-ValueType
low complexity region 51 67 N/A INTRINSIC
BCL 106 197 4.19e0 SMART
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145948
SMART Domains Protein: ENSMUSP00000117529
Gene: ENSMUSG00000004446

DomainStartEndE-ValueType
Pfam:BID 1 52 1.7e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160684
AA Change: A110T

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125731
Gene: ENSMUSG00000004446
AA Change: A110T

DomainStartEndE-ValueType
Pfam:BID 1 195 3.8e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161594
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a death agonist that heterodimerizes with either agonist BAX or antagonist BCL2. The encoded protein is a member of the BCL-2 family of cell death regulators. It is a mediator of mitochondrial damage induced by caspase-8 (CASP8); CASP8 cleaves this encoded protein, and the COOH-terminal part translocates to mitochondria where it triggers cytochrome c release. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants survive with little or no liver damage after injection with antibody against Fas, whereas mice normally die from hepatocellular apoptosis and hemorragic necrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amph G A 13: 19,142,028 V643M probably damaging Het
Cd209d T A 8: 3,872,027 D185V probably damaging Het
Cdc42bpb T C 12: 111,296,441 Y1484C probably damaging Het
Cdh9 T C 15: 16,850,792 V549A probably benign Het
Cmya5 C T 13: 93,041,535 V3604M possibly damaging Het
Eprs T A 1: 185,387,089 W489R probably damaging Het
Galnt14 T A 17: 73,526,290 I230F probably damaging Het
Gm19965 A G 1: 116,804,619 K64R possibly damaging Het
Gpr141 T G 13: 19,751,864 Y247S possibly damaging Het
Ivd A T 2: 118,869,442 H52L probably benign Het
Marc1 C T 1: 184,803,941 R98Q probably benign Het
Mcoln2 A G 3: 146,180,174 H260R probably benign Het
Mdga2 T C 12: 66,716,742 probably null Het
Ndrg3 T C 2: 156,946,008 probably benign Het
Olfr166 T C 16: 19,487,053 Y72H probably benign Het
Pcdhb17 A T 18: 37,486,234 N359I probably damaging Het
Phf24 G A 4: 42,934,657 V98I probably benign Het
Pkhd1 C A 1: 20,571,405 G270W probably damaging Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Prss51 T G 14: 64,096,171 probably null Het
Scarb2 C T 5: 92,451,346 probably null Het
Simc1 ACCA ACCANNNNNNNNNNNNNNNNNNCCA 13: 54,525,265 probably benign Het
Slco1c1 T A 6: 141,542,127 Y192N probably damaging Het
Smco2 T C 6: 146,862,087 probably benign Het
Snx13 A G 12: 35,132,124 D724G probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sytl4 GAAAAAA GAAAAA X: 133,961,126 probably benign Het
Tnr A G 1: 159,868,030 T508A probably benign Het
Vmn1r30 A G 6: 58,435,095 S251P probably damaging Het
Zdhhc16 T A 19: 41,940,634 probably null Het
Other mutations in Bid
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1331:Bid UTSW 6 120897255 missense possibly damaging 0.82
R1332:Bid UTSW 6 120897255 missense possibly damaging 0.82
R1333:Bid UTSW 6 120897255 missense possibly damaging 0.82
R1760:Bid UTSW 6 120900248 missense possibly damaging 0.65
R1930:Bid UTSW 6 120897255 missense possibly damaging 0.82
R1932:Bid UTSW 6 120897255 missense possibly damaging 0.82
R2152:Bid UTSW 6 120900254 missense probably damaging 1.00
R4937:Bid UTSW 6 120895746 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GGCAGTCAAGGACAGGGTTTACTTC -3'
(R):5'- CATTAAAGCAGCAGTGACACAGGC -3'

Sequencing Primer
(F):5'- CCTGGGAAAGACTGGTTCGAC -3'
(R):5'- TCATGGTCCTCACTAGGGCAG -3'
Posted On2014-02-11