Incidental Mutation 'R1335:Cd209d'
ID156844
Institutional Source Beutler Lab
Gene Symbol Cd209d
Ensembl Gene ENSMUSG00000031495
Gene NameCD209d antigen
SynonymsSIGN-R3, mSIGNR3, SIGNR3
MMRRC Submission 039400-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1335 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3871824-3878555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3872027 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 185 (D185V)
Ref Sequence ENSEMBL: ENSMUSP00000147198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011445] [ENSMUST00000209176]
Predicted Effect probably damaging
Transcript: ENSMUST00000011445
AA Change: D215V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000011445
Gene: ENSMUSG00000031495
AA Change: D215V

DomainStartEndE-ValueType
low complexity region 54 74 N/A INTRINSIC
CLECT 106 227 2.34e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209176
AA Change: D185V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.424 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to bacterial infection despite decreased T and B cell proliferation and extramedullary hematopoiesis in the spleen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amph G A 13: 19,142,028 V643M probably damaging Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cdc42bpb T C 12: 111,296,441 Y1484C probably damaging Het
Cdh9 T C 15: 16,850,792 V549A probably benign Het
Cmya5 C T 13: 93,041,535 V3604M possibly damaging Het
Eprs T A 1: 185,387,089 W489R probably damaging Het
Galnt14 T A 17: 73,526,290 I230F probably damaging Het
Gm19965 A G 1: 116,804,619 K64R possibly damaging Het
Gpr141 T G 13: 19,751,864 Y247S possibly damaging Het
Ivd A T 2: 118,869,442 H52L probably benign Het
Marc1 C T 1: 184,803,941 R98Q probably benign Het
Mcoln2 A G 3: 146,180,174 H260R probably benign Het
Mdga2 T C 12: 66,716,742 probably null Het
Ndrg3 T C 2: 156,946,008 probably benign Het
Olfr166 T C 16: 19,487,053 Y72H probably benign Het
Pcdhb17 A T 18: 37,486,234 N359I probably damaging Het
Phf24 G A 4: 42,934,657 V98I probably benign Het
Pkhd1 C A 1: 20,571,405 G270W probably damaging Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Prss51 T G 14: 64,096,171 probably null Het
Scarb2 C T 5: 92,451,346 probably null Het
Simc1 ACCA ACCANNNNNNNNNNNNNNNNNNCCA 13: 54,525,265 probably benign Het
Slco1c1 T A 6: 141,542,127 Y192N probably damaging Het
Smco2 T C 6: 146,862,087 probably benign Het
Snx13 A G 12: 35,132,124 D724G probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sytl4 GAAAAAA GAAAAA X: 133,961,126 probably benign Het
Tnr A G 1: 159,868,030 T508A probably benign Het
Vmn1r30 A G 6: 58,435,095 S251P probably damaging Het
Zdhhc16 T A 19: 41,940,634 probably null Het
Other mutations in Cd209d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Cd209d APN 8 3877974 splice site probably null
IGL01707:Cd209d APN 8 3878296 missense probably benign
IGL02864:Cd209d APN 8 3877122 missense probably benign 0.08
IGL03066:Cd209d APN 8 3878437 critical splice donor site probably null
IGL03297:Cd209d APN 8 3878476 missense possibly damaging 0.92
R0324:Cd209d UTSW 8 3878258 missense probably benign 0.31
R1349:Cd209d UTSW 8 3878515 unclassified probably benign
R1372:Cd209d UTSW 8 3878515 unclassified probably benign
R1507:Cd209d UTSW 8 3878453 missense possibly damaging 0.72
R1673:Cd209d UTSW 8 3877113 missense probably damaging 1.00
R2393:Cd209d UTSW 8 3878436 critical splice donor site probably null
R2567:Cd209d UTSW 8 3876327 missense probably damaging 1.00
R4907:Cd209d UTSW 8 3877948 missense probably benign 0.01
R5349:Cd209d UTSW 8 3878320 missense probably benign 0.00
R5768:Cd209d UTSW 8 3871968 missense probably benign 0.05
R5949:Cd209d UTSW 8 3877949 missense possibly damaging 0.50
R5953:Cd209d UTSW 8 3877979 splice site probably null
R6103:Cd209d UTSW 8 3878304 missense probably damaging 1.00
X0025:Cd209d UTSW 8 3877961 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAGAAGGAGCACGAACATGAGGGA -3'
(R):5'- ACAGTGGGCCAGATTAAAGTACTGTGAA -3'

Sequencing Primer
(F):5'- GGACATGAGTCAGGTTCATCC -3'
(R):5'- cttcctcctctccaatgctc -3'
Posted On2014-02-11