Incidental Mutation 'R1335:Gpr141'
ID156849
Institutional Source Beutler Lab
Gene Symbol Gpr141
Ensembl Gene ENSMUSG00000053101
Gene NameG protein-coupled receptor 141
SynonymsPgr13
MMRRC Submission 039400-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1335 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location19749682-19824257 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 19751864 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 247 (Y247S)
Ref Sequence ENSEMBL: ENSMUSP00000066921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065335] [ENSMUST00000222664]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065335
AA Change: Y247S

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066921
Gene: ENSMUSG00000053101
AA Change: Y247S

DomainStartEndE-ValueType
Pfam:7tm_1 34 283 6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222664
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GPR141 is a member of the rhodopsin family of G protein-coupled receptors (GPRs) (Fredriksson et al., 2003 [PubMed 14623098]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amph G A 13: 19,142,028 V643M probably damaging Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cd209d T A 8: 3,872,027 D185V probably damaging Het
Cdc42bpb T C 12: 111,296,441 Y1484C probably damaging Het
Cdh9 T C 15: 16,850,792 V549A probably benign Het
Cmya5 C T 13: 93,041,535 V3604M possibly damaging Het
Eprs T A 1: 185,387,089 W489R probably damaging Het
Galnt14 T A 17: 73,526,290 I230F probably damaging Het
Gm19965 A G 1: 116,804,619 K64R possibly damaging Het
Ivd A T 2: 118,869,442 H52L probably benign Het
Marc1 C T 1: 184,803,941 R98Q probably benign Het
Mcoln2 A G 3: 146,180,174 H260R probably benign Het
Mdga2 T C 12: 66,716,742 probably null Het
Ndrg3 T C 2: 156,946,008 probably benign Het
Olfr166 T C 16: 19,487,053 Y72H probably benign Het
Pcdhb17 A T 18: 37,486,234 N359I probably damaging Het
Phf24 G A 4: 42,934,657 V98I probably benign Het
Pkhd1 C A 1: 20,571,405 G270W probably damaging Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Prss51 T G 14: 64,096,171 probably null Het
Scarb2 C T 5: 92,451,346 probably null Het
Simc1 ACCA ACCANNNNNNNNNNNNNNNNNNCCA 13: 54,525,265 probably benign Het
Slco1c1 T A 6: 141,542,127 Y192N probably damaging Het
Smco2 T C 6: 146,862,087 probably benign Het
Snx13 A G 12: 35,132,124 D724G probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sytl4 GAAAAAA GAAAAA X: 133,961,126 probably benign Het
Tnr A G 1: 159,868,030 T508A probably benign Het
Vmn1r30 A G 6: 58,435,095 S251P probably damaging Het
Zdhhc16 T A 19: 41,940,634 probably null Het
Other mutations in Gpr141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Gpr141 APN 13 19752599 missense probably benign 0.02
IGL01982:Gpr141 APN 13 19751738 missense probably benign 0.37
R0028:Gpr141 UTSW 13 19752429 missense probably damaging 1.00
R0138:Gpr141 UTSW 13 19752258 missense probably benign 0.29
R1033:Gpr141 UTSW 13 19751710 missense probably benign
R1623:Gpr141 UTSW 13 19751912 unclassified probably null
R4027:Gpr141 UTSW 13 19751825 missense probably benign 0.00
R4686:Gpr141 UTSW 13 19751781 missense probably benign 0.15
R4744:Gpr141 UTSW 13 19751714 missense probably benign 0.40
R5154:Gpr141 UTSW 13 19752242 missense probably benign
R6219:Gpr141 UTSW 13 19752527 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCATGGACACCTTCCCACAC -3'
(R):5'- TGGGTTTCCAGGTCTTCATCACATTG -3'

Sequencing Primer
(F):5'- CCAAGGCCAGGTTTCAATG -3'
(R):5'- ATTGTCCATGGTGCGGAA -3'
Posted On2014-02-11