Incidental Mutation 'R1335:Prss51'
ID156852
Institutional Source Beutler Lab
Gene Symbol Prss51
Ensembl Gene ENSMUSG00000052099
Gene Nameprotease, serine 51
Synonyms1700007N14Rik
MMRRC Submission 039400-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R1335 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location64086234-64097678 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 64096171 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063785] [ENSMUST00000165710] [ENSMUST00000170709] [ENSMUST00000224112]
Predicted Effect probably null
Transcript: ENSMUST00000063785
SMART Domains Protein: ENSMUSP00000066111
Gene: ENSMUSG00000052099

DomainStartEndE-ValueType
Tryp_SPc 5 171 3.93e-9 SMART
low complexity region 181 195 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165710
SMART Domains Protein: ENSMUSP00000132814
Gene: ENSMUSG00000052099

DomainStartEndE-ValueType
Tryp_SPc 9 189 2.09e-13 SMART
low complexity region 199 213 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166038
Predicted Effect probably null
Transcript: ENSMUST00000170709
SMART Domains Protein: ENSMUSP00000126778
Gene: ENSMUSG00000052099

DomainStartEndE-ValueType
Pfam:Trypsin 2 94 2e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000224112
Meta Mutation Damage Score 0.6176 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amph G A 13: 19,142,028 V643M probably damaging Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cd209d T A 8: 3,872,027 D185V probably damaging Het
Cdc42bpb T C 12: 111,296,441 Y1484C probably damaging Het
Cdh9 T C 15: 16,850,792 V549A probably benign Het
Cmya5 C T 13: 93,041,535 V3604M possibly damaging Het
Eprs T A 1: 185,387,089 W489R probably damaging Het
Galnt14 T A 17: 73,526,290 I230F probably damaging Het
Gm19965 A G 1: 116,804,619 K64R possibly damaging Het
Gpr141 T G 13: 19,751,864 Y247S possibly damaging Het
Ivd A T 2: 118,869,442 H52L probably benign Het
Marc1 C T 1: 184,803,941 R98Q probably benign Het
Mcoln2 A G 3: 146,180,174 H260R probably benign Het
Mdga2 T C 12: 66,716,742 probably null Het
Ndrg3 T C 2: 156,946,008 probably benign Het
Olfr166 T C 16: 19,487,053 Y72H probably benign Het
Pcdhb17 A T 18: 37,486,234 N359I probably damaging Het
Phf24 G A 4: 42,934,657 V98I probably benign Het
Pkhd1 C A 1: 20,571,405 G270W probably damaging Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Scarb2 C T 5: 92,451,346 probably null Het
Simc1 ACCA ACCANNNNNNNNNNNNNNNNNNCCA 13: 54,525,265 probably benign Het
Slco1c1 T A 6: 141,542,127 Y192N probably damaging Het
Smco2 T C 6: 146,862,087 probably benign Het
Snx13 A G 12: 35,132,124 D724G probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sytl4 GAAAAAA GAAAAA X: 133,961,126 probably benign Het
Tnr A G 1: 159,868,030 T508A probably benign Het
Vmn1r30 A G 6: 58,435,095 S251P probably damaging Het
Zdhhc16 T A 19: 41,940,634 probably null Het
Other mutations in Prss51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Prss51 APN 14 64095984 missense probably damaging 1.00
R0453:Prss51 UTSW 14 64097139 missense probably damaging 1.00
R1479:Prss51 UTSW 14 64096170 critical splice donor site probably null
R3753:Prss51 UTSW 14 64096175 splice site probably benign
R5384:Prss51 UTSW 14 64097094 missense probably damaging 0.99
R5385:Prss51 UTSW 14 64097094 missense probably damaging 0.99
R5386:Prss51 UTSW 14 64097094 missense probably damaging 0.99
R6522:Prss51 UTSW 14 64097406 missense possibly damaging 0.90
R6722:Prss51 UTSW 14 64095059 missense probably damaging 0.99
R6908:Prss51 UTSW 14 64096152 missense probably benign 0.00
R6919:Prss51 UTSW 14 64097488 missense probably damaging 1.00
X0024:Prss51 UTSW 14 64097466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCCACCACCATTGTCAGCTATTG -3'
(R):5'- AACTGAGGGGCATTGCTGTCGTTC -3'

Sequencing Primer
(F):5'- CCTCAGATTAGAACTGGTAGCAGTC -3'
(R):5'- TTTTGCTCAGCAGAGGGCAA -3'
Posted On2014-02-11