Incidental Mutation 'R1335:Cdh9'
ID156853
Institutional Source Beutler Lab
Gene Symbol Cdh9
Ensembl Gene ENSMUSG00000025370
Gene Namecadherin 9
SynonymsT1-cadherin
MMRRC Submission 039400-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R1335 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location16728756-16857094 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16850792 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 549 (V549A)
Ref Sequence ENSEMBL: ENSMUSP00000154022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026432] [ENSMUST00000228307]
Predicted Effect probably benign
Transcript: ENSMUST00000026432
AA Change: V549A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000026432
Gene: ENSMUSG00000025370
AA Change: V549A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 75 156 2.84e-15 SMART
CA 180 265 5.63e-28 SMART
CA 289 381 1.12e-13 SMART
CA 404 485 8.03e-24 SMART
CA 508 595 1.34e-2 SMART
transmembrane domain 613 635 N/A INTRINSIC
Pfam:Cadherin_C 638 782 1.5e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227900
Predicted Effect probably benign
Transcript: ENSMUST00000228307
AA Change: V549A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.1328 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily, integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of 5 subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout results in the formation of abnormal axonal arbors in some retinal type 5 bipolar cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amph G A 13: 19,142,028 V643M probably damaging Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cd209d T A 8: 3,872,027 D185V probably damaging Het
Cdc42bpb T C 12: 111,296,441 Y1484C probably damaging Het
Cmya5 C T 13: 93,041,535 V3604M possibly damaging Het
Eprs T A 1: 185,387,089 W489R probably damaging Het
Galnt14 T A 17: 73,526,290 I230F probably damaging Het
Gm19965 A G 1: 116,804,619 K64R possibly damaging Het
Gpr141 T G 13: 19,751,864 Y247S possibly damaging Het
Ivd A T 2: 118,869,442 H52L probably benign Het
Marc1 C T 1: 184,803,941 R98Q probably benign Het
Mcoln2 A G 3: 146,180,174 H260R probably benign Het
Mdga2 T C 12: 66,716,742 probably null Het
Ndrg3 T C 2: 156,946,008 probably benign Het
Olfr166 T C 16: 19,487,053 Y72H probably benign Het
Pcdhb17 A T 18: 37,486,234 N359I probably damaging Het
Phf24 G A 4: 42,934,657 V98I probably benign Het
Pkhd1 C A 1: 20,571,405 G270W probably damaging Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Prss51 T G 14: 64,096,171 probably null Het
Scarb2 C T 5: 92,451,346 probably null Het
Simc1 ACCA ACCANNNNNNNNNNNNNNNNNNCCA 13: 54,525,265 probably benign Het
Slco1c1 T A 6: 141,542,127 Y192N probably damaging Het
Smco2 T C 6: 146,862,087 probably benign Het
Snx13 A G 12: 35,132,124 D724G probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sytl4 GAAAAAA GAAAAA X: 133,961,126 probably benign Het
Tnr A G 1: 159,868,030 T508A probably benign Het
Vmn1r30 A G 6: 58,435,095 S251P probably damaging Het
Zdhhc16 T A 19: 41,940,634 probably null Het
Other mutations in Cdh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Cdh9 APN 15 16828362 missense probably damaging 1.00
IGL00555:Cdh9 APN 15 16823406 missense probably damaging 1.00
IGL01110:Cdh9 APN 15 16855926 missense possibly damaging 0.63
IGL01432:Cdh9 APN 15 16830947 missense probably damaging 1.00
IGL01768:Cdh9 APN 15 16778225 missense possibly damaging 0.51
IGL02043:Cdh9 APN 15 16856232 missense probably damaging 1.00
IGL02304:Cdh9 APN 15 16848601 missense probably benign 0.01
IGL02380:Cdh9 APN 15 16856000 missense possibly damaging 0.79
IGL02505:Cdh9 APN 15 16855989 missense probably damaging 1.00
IGL02675:Cdh9 APN 15 16849076 splice site probably null
IGL02679:Cdh9 APN 15 16832230 missense probably damaging 0.97
IGL03288:Cdh9 APN 15 16856049 missense probably damaging 1.00
R0426:Cdh9 UTSW 15 16823454 critical splice donor site probably null
R0726:Cdh9 UTSW 15 16831044 missense probably benign 0.00
R1368:Cdh9 UTSW 15 16848482 splice site probably benign
R1766:Cdh9 UTSW 15 16778306 missense probably damaging 1.00
R1916:Cdh9 UTSW 15 16823275 missense probably benign 0.03
R2325:Cdh9 UTSW 15 16778200 missense probably benign
R2424:Cdh9 UTSW 15 16850354 missense probably damaging 1.00
R3104:Cdh9 UTSW 15 16855814 missense probably damaging 1.00
R3837:Cdh9 UTSW 15 16823438 nonsense probably null
R3839:Cdh9 UTSW 15 16823438 nonsense probably null
R4241:Cdh9 UTSW 15 16849079 critical splice acceptor site probably null
R4248:Cdh9 UTSW 15 16850388 missense probably benign 0.00
R4576:Cdh9 UTSW 15 16832239 missense possibly damaging 0.73
R4679:Cdh9 UTSW 15 16850959 missense probably benign
R4896:Cdh9 UTSW 15 16778156 missense probably benign 0.12
R4961:Cdh9 UTSW 15 16850828 missense probably benign
R5050:Cdh9 UTSW 15 16778147 missense probably benign 0.12
R5089:Cdh9 UTSW 15 16778276 missense probably damaging 1.00
R5268:Cdh9 UTSW 15 16851013 missense probably benign
R5567:Cdh9 UTSW 15 16855844 missense probably damaging 1.00
R5646:Cdh9 UTSW 15 16823285 missense probably damaging 1.00
R5894:Cdh9 UTSW 15 16832100 missense possibly damaging 0.47
R6440:Cdh9 UTSW 15 16823423 missense probably benign 0.01
R6441:Cdh9 UTSW 15 16823423 missense probably benign 0.01
X0062:Cdh9 UTSW 15 16848539 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCTTTGAGCCAGTGCCAGAATTTCC -3'
(R):5'- GACTGCATGTTCCCCAGGTTATCG -3'

Sequencing Primer
(F):5'- ggaagtgacctcaggaacaac -3'
(R):5'- GTGCCAGTGCTGCTTTGAAT -3'
Posted On2014-02-11