Incidental Mutation 'R1335:Cdh9'
ID 156853
Institutional Source Beutler Lab
Gene Symbol Cdh9
Ensembl Gene ENSMUSG00000025370
Gene Name cadherin 9
Synonyms T1-cadherin
MMRRC Submission 039400-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R1335 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 16728842-16857180 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16850878 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 549 (V549A)
Ref Sequence ENSEMBL: ENSMUSP00000154022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026432] [ENSMUST00000228307]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000026432
AA Change: V549A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000026432
Gene: ENSMUSG00000025370
AA Change: V549A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 75 156 2.84e-15 SMART
CA 180 265 5.63e-28 SMART
CA 289 381 1.12e-13 SMART
CA 404 485 8.03e-24 SMART
CA 508 595 1.34e-2 SMART
transmembrane domain 613 635 N/A INTRINSIC
Pfam:Cadherin_C 638 782 1.5e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227900
Predicted Effect probably benign
Transcript: ENSMUST00000228307
AA Change: V549A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily, integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of 5 subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout results in the formation of abnormal axonal arbors in some retinal type 5 bipolar cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amph G A 13: 19,326,198 (GRCm39) V643M probably damaging Het
Bid C T 6: 120,874,216 (GRCm39) A110T possibly damaging Het
Cd209d T A 8: 3,922,027 (GRCm39) D185V probably damaging Het
Cdc42bpb T C 12: 111,262,875 (GRCm39) Y1484C probably damaging Het
Cmya5 C T 13: 93,178,043 (GRCm39) V3604M possibly damaging Het
Eprs1 T A 1: 185,119,286 (GRCm39) W489R probably damaging Het
Galnt14 T A 17: 73,833,285 (GRCm39) I230F probably damaging Het
Gm19965 A G 1: 116,732,349 (GRCm39) K64R possibly damaging Het
Gpr141 T G 13: 19,936,034 (GRCm39) Y247S possibly damaging Het
Ivd A T 2: 118,699,923 (GRCm39) H52L probably benign Het
Mcoln2 A G 3: 145,885,929 (GRCm39) H260R probably benign Het
Mdga2 T C 12: 66,763,516 (GRCm39) probably null Het
Mtarc1 C T 1: 184,536,138 (GRCm39) R98Q probably benign Het
Ndrg3 T C 2: 156,787,928 (GRCm39) probably benign Het
Or2l13 T C 16: 19,305,803 (GRCm39) Y72H probably benign Het
Pcdhb17 A T 18: 37,619,287 (GRCm39) N359I probably damaging Het
Phf24 G A 4: 42,934,657 (GRCm39) V98I probably benign Het
Pkhd1 C A 1: 20,641,629 (GRCm39) G270W probably damaging Het
Pkhd1l1 G A 15: 44,368,943 (GRCm39) V863I probably damaging Het
Prss51 T G 14: 64,333,620 (GRCm39) probably null Het
Scarb2 C T 5: 92,599,205 (GRCm39) probably null Het
Simc1 ACCA ACCANNNNNNNNNNNNNNNNNNCCA 13: 54,673,078 (GRCm39) probably benign Het
Slco1c1 T A 6: 141,487,853 (GRCm39) Y192N probably damaging Het
Smco2 T C 6: 146,763,585 (GRCm39) probably benign Het
Snx13 A G 12: 35,182,123 (GRCm39) D724G probably benign Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Sytl4 GAAAAAA GAAAAA X: 132,861,875 (GRCm39) probably benign Het
Tnr A G 1: 159,695,600 (GRCm39) T508A probably benign Het
Vmn1r30 A G 6: 58,412,080 (GRCm39) S251P probably damaging Het
Zdhhc16 T A 19: 41,929,073 (GRCm39) probably null Het
Other mutations in Cdh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Cdh9 APN 15 16,828,448 (GRCm39) missense probably damaging 1.00
IGL00555:Cdh9 APN 15 16,823,492 (GRCm39) missense probably damaging 1.00
IGL01110:Cdh9 APN 15 16,856,012 (GRCm39) missense possibly damaging 0.63
IGL01432:Cdh9 APN 15 16,831,033 (GRCm39) missense probably damaging 1.00
IGL01768:Cdh9 APN 15 16,778,311 (GRCm39) missense possibly damaging 0.51
IGL02043:Cdh9 APN 15 16,856,318 (GRCm39) missense probably damaging 1.00
IGL02304:Cdh9 APN 15 16,848,687 (GRCm39) missense probably benign 0.01
IGL02380:Cdh9 APN 15 16,856,086 (GRCm39) missense possibly damaging 0.79
IGL02505:Cdh9 APN 15 16,856,075 (GRCm39) missense probably damaging 1.00
IGL02675:Cdh9 APN 15 16,849,162 (GRCm39) splice site probably null
IGL02679:Cdh9 APN 15 16,832,316 (GRCm39) missense probably damaging 0.97
IGL03288:Cdh9 APN 15 16,856,135 (GRCm39) missense probably damaging 1.00
R0426:Cdh9 UTSW 15 16,823,540 (GRCm39) critical splice donor site probably null
R0726:Cdh9 UTSW 15 16,831,130 (GRCm39) missense probably benign 0.00
R1368:Cdh9 UTSW 15 16,848,568 (GRCm39) splice site probably benign
R1766:Cdh9 UTSW 15 16,778,392 (GRCm39) missense probably damaging 1.00
R1916:Cdh9 UTSW 15 16,823,361 (GRCm39) missense probably benign 0.03
R2325:Cdh9 UTSW 15 16,778,286 (GRCm39) missense probably benign
R2424:Cdh9 UTSW 15 16,850,440 (GRCm39) missense probably damaging 1.00
R3104:Cdh9 UTSW 15 16,855,900 (GRCm39) missense probably damaging 1.00
R3837:Cdh9 UTSW 15 16,823,524 (GRCm39) nonsense probably null
R3839:Cdh9 UTSW 15 16,823,524 (GRCm39) nonsense probably null
R4241:Cdh9 UTSW 15 16,849,165 (GRCm39) critical splice acceptor site probably null
R4248:Cdh9 UTSW 15 16,850,474 (GRCm39) missense probably benign 0.00
R4576:Cdh9 UTSW 15 16,832,325 (GRCm39) missense possibly damaging 0.73
R4679:Cdh9 UTSW 15 16,851,045 (GRCm39) missense probably benign
R4896:Cdh9 UTSW 15 16,778,242 (GRCm39) missense probably benign 0.12
R4961:Cdh9 UTSW 15 16,850,914 (GRCm39) missense probably benign
R5050:Cdh9 UTSW 15 16,778,233 (GRCm39) missense probably benign 0.12
R5089:Cdh9 UTSW 15 16,778,362 (GRCm39) missense probably damaging 1.00
R5268:Cdh9 UTSW 15 16,851,099 (GRCm39) missense probably benign
R5567:Cdh9 UTSW 15 16,855,930 (GRCm39) missense probably damaging 1.00
R5646:Cdh9 UTSW 15 16,823,371 (GRCm39) missense probably damaging 1.00
R5894:Cdh9 UTSW 15 16,832,186 (GRCm39) missense possibly damaging 0.47
R6440:Cdh9 UTSW 15 16,823,509 (GRCm39) missense probably benign 0.01
R6441:Cdh9 UTSW 15 16,823,509 (GRCm39) missense probably benign 0.01
R7225:Cdh9 UTSW 15 16,856,159 (GRCm39) missense probably damaging 1.00
R7247:Cdh9 UTSW 15 16,778,341 (GRCm39) missense probably damaging 1.00
R7593:Cdh9 UTSW 15 16,823,261 (GRCm39) missense probably damaging 1.00
R7615:Cdh9 UTSW 15 16,856,316 (GRCm39) missense probably damaging 1.00
R7632:Cdh9 UTSW 15 16,851,115 (GRCm39) splice site probably null
R7991:Cdh9 UTSW 15 16,828,489 (GRCm39) missense probably damaging 1.00
R8035:Cdh9 UTSW 15 16,831,152 (GRCm39) missense probably damaging 0.97
R8834:Cdh9 UTSW 15 16,850,964 (GRCm39) missense probably damaging 1.00
R8909:Cdh9 UTSW 15 16,848,610 (GRCm39) missense probably damaging 1.00
R8936:Cdh9 UTSW 15 16,831,162 (GRCm39) critical splice donor site probably null
R8973:Cdh9 UTSW 15 16,831,131 (GRCm39) missense possibly damaging 0.78
R9138:Cdh9 UTSW 15 16,823,273 (GRCm39) missense probably damaging 1.00
R9305:Cdh9 UTSW 15 16,832,138 (GRCm39) missense probably damaging 1.00
RF006:Cdh9 UTSW 15 16,855,916 (GRCm39) missense probably damaging 0.97
X0062:Cdh9 UTSW 15 16,848,625 (GRCm39) missense possibly damaging 0.81
Z1177:Cdh9 UTSW 15 16,850,450 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCTTTGAGCCAGTGCCAGAATTTCC -3'
(R):5'- GACTGCATGTTCCCCAGGTTATCG -3'

Sequencing Primer
(F):5'- ggaagtgacctcaggaacaac -3'
(R):5'- GTGCCAGTGCTGCTTTGAAT -3'
Posted On 2014-02-11