Incidental Mutation 'R1335:Olfr166'
ID156855
Institutional Source Beutler Lab
Gene Symbol Olfr166
Ensembl Gene ENSMUSG00000056822
Gene Nameolfactory receptor 166
SynonymsGA_x54KRFPKG5P-15934912-15935850, MOR270-1
MMRRC Submission 039400-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1335 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location19483694-19489882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19487053 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 72 (Y72H)
Ref Sequence ENSEMBL: ENSMUSP00000150764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074739] [ENSMUST00000213531] [ENSMUST00000216465]
Predicted Effect probably benign
Transcript: ENSMUST00000074739
AA Change: Y72H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000074299
Gene: ENSMUSG00000056822
AA Change: Y72H

DomainStartEndE-ValueType
low complexity region 12 29 N/A INTRINSIC
Pfam:7tm_4 30 306 4e-50 PFAM
Pfam:7TM_GPCR_Srsx 33 295 3.6e-7 PFAM
Pfam:7tm_1 40 289 2.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213531
AA Change: Y72H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000216465
AA Change: Y72H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amph G A 13: 19,142,028 V643M probably damaging Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cd209d T A 8: 3,872,027 D185V probably damaging Het
Cdc42bpb T C 12: 111,296,441 Y1484C probably damaging Het
Cdh9 T C 15: 16,850,792 V549A probably benign Het
Cmya5 C T 13: 93,041,535 V3604M possibly damaging Het
Eprs T A 1: 185,387,089 W489R probably damaging Het
Galnt14 T A 17: 73,526,290 I230F probably damaging Het
Gm19965 A G 1: 116,804,619 K64R possibly damaging Het
Gpr141 T G 13: 19,751,864 Y247S possibly damaging Het
Ivd A T 2: 118,869,442 H52L probably benign Het
Marc1 C T 1: 184,803,941 R98Q probably benign Het
Mcoln2 A G 3: 146,180,174 H260R probably benign Het
Mdga2 T C 12: 66,716,742 probably null Het
Ndrg3 T C 2: 156,946,008 probably benign Het
Pcdhb17 A T 18: 37,486,234 N359I probably damaging Het
Phf24 G A 4: 42,934,657 V98I probably benign Het
Pkhd1 C A 1: 20,571,405 G270W probably damaging Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Prss51 T G 14: 64,096,171 probably null Het
Scarb2 C T 5: 92,451,346 probably null Het
Simc1 ACCA ACCANNNNNNNNNNNNNNNNNNCCA 13: 54,525,265 probably benign Het
Slco1c1 T A 6: 141,542,127 Y192N probably damaging Het
Smco2 T C 6: 146,862,087 probably benign Het
Snx13 A G 12: 35,132,124 D724G probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sytl4 GAAAAAA GAAAAA X: 133,961,126 probably benign Het
Tnr A G 1: 159,868,030 T508A probably benign Het
Vmn1r30 A G 6: 58,435,095 S251P probably damaging Het
Zdhhc16 T A 19: 41,940,634 probably null Het
Other mutations in Olfr166
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Olfr166 APN 16 19487459 missense probably benign 0.13
IGL01639:Olfr166 APN 16 19487164 missense probably damaging 0.97
IGL02105:Olfr166 APN 16 19487261 missense probably benign 0.15
IGL02352:Olfr166 APN 16 19487177 missense probably damaging 1.00
IGL02359:Olfr166 APN 16 19487177 missense probably damaging 1.00
IGL03053:Olfr166 APN 16 19487219 missense probably benign 0.36
IGL03168:Olfr166 APN 16 19487219 missense probably benign 0.36
R0576:Olfr166 UTSW 16 19487188 missense probably damaging 1.00
R0920:Olfr166 UTSW 16 19486930 missense probably benign 0.00
R1468:Olfr166 UTSW 16 19487628 missense probably benign 0.15
R1468:Olfr166 UTSW 16 19487628 missense probably benign 0.15
R1490:Olfr166 UTSW 16 19486922 missense probably benign
R2095:Olfr166 UTSW 16 19486931 missense probably benign
R3123:Olfr166 UTSW 16 19487015 missense probably damaging 1.00
R4893:Olfr166 UTSW 16 19486903 missense probably benign
R5093:Olfr166 UTSW 16 19487477 missense probably damaging 1.00
R5222:Olfr166 UTSW 16 19486930 missense probably benign
R7149:Olfr166 UTSW 16 19487510 missense not run
X0020:Olfr166 UTSW 16 19487090 missense probably benign 0.22
Z1088:Olfr166 UTSW 16 19487048 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TCTGTTAGGACTGCTTCCACAAAACC -3'
(R):5'- GCTTGTGCTCACAAACACCATGTACTC -3'

Sequencing Primer
(F):5'- TGCTTCCACAAAACCAAACAGG -3'
(R):5'- GTTGATTGAGCCCAATATCCAGG -3'
Posted On2014-02-11