Mutagenetix > Incidental Mutation

Incidental Mutation 'R1337:Casp8ap2'

156895

Institutional Source

Beutler Lab

Gene Symbol

Casp8ap2

Ensembl Gene

ENSMUSG00000028282

Gene Name

caspase 8 associated protein 2

Synonyms

FLASH, D4Ertd659e

MMRRC Submission

039402-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1337 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32615462-32653271 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32645721 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1598 (V1598A)

Ref Sequence

ENSEMBL: ENSMUSP00000136016 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]

AlphaFold

Q9WUF3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029950
AA Change: V1598A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: V1598A

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000108178

SMART Domains

Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

Domain	Start	End	E-Value	Type
PDB:2LR8\|A	126	190	4e-26	PDB
Blast:SANT	139	183	4e-19	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000178925
AA Change: V1598A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: V1598A

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730522E02Rik	A	G	11: 25,719,033 (GRCm39)	S37P	unknown	Het
Abca12	T	C	1: 71,333,978 (GRCm39)	I1175V	probably benign	Het
Ager	G	T	17: 34,819,596 (GRCm39)		probably null	Het
Amph	G	A	13: 19,326,198 (GRCm39)	V643M	probably damaging	Het
Cacna1c	A	G	6: 118,604,416 (GRCm39)	I1278T	probably damaging	Het
Cdk12	T	C	11: 98,136,497 (GRCm39)		probably null	Het
Ces2g	A	T	8: 105,690,597 (GRCm39)	Y126F	possibly damaging	Het
Ehbp1l1	A	T	19: 5,768,258 (GRCm39)	M1015K	probably benign	Het
Engase	A	G	11: 118,373,400 (GRCm39)	T248A	possibly damaging	Het
Gsdma	C	T	11: 98,560,533 (GRCm39)	Q162*	probably null	Het
Hapln3	T	C	7: 78,767,824 (GRCm39)	E190G	probably benign	Het
Hdc	T	C	2: 126,458,196 (GRCm39)	Q42R	probably benign	Het
Larp1b	C	T	3: 40,987,837 (GRCm39)	P20S	probably damaging	Het
Macf1	T	G	4: 123,370,068 (GRCm39)	R1564S	probably benign	Het
Muc5b	A	G	7: 141,412,361 (GRCm39)	Y1769C	unknown	Het
Nup88	T	A	11: 70,835,716 (GRCm39)	Q576L	probably damaging	Het
Or51f1	T	C	7: 102,506,078 (GRCm39)	N137S	probably benign	Het
Or7g21	A	G	9: 19,033,099 (GRCm39)	I280V	probably benign	Het
Prune2	C	T	19: 17,096,971 (GRCm39)	S825L	possibly damaging	Het
Ryr3	C	A	2: 112,610,308 (GRCm39)	M2301I	possibly damaging	Het
Sdk2	A	C	11: 113,723,157 (GRCm39)	V1278G	possibly damaging	Het
Sertad3	T	C	7: 27,175,866 (GRCm39)	L100P	probably damaging	Het
Slco5a1	T	C	1: 13,009,366 (GRCm39)	T370A	probably benign	Het
Srrm1	A	G	4: 135,074,044 (GRCm39)		probably null	Het
Stk32a	A	G	18: 43,394,414 (GRCm39)	D121G	probably benign	Het
Ttc7	A	T	17: 87,597,724 (GRCm39)	R99W	probably damaging	Het
Xkr9	C	A	1: 13,771,348 (GRCm39)	S288Y	possibly damaging	Het
Zfp644	A	G	5: 106,785,420 (GRCm39)	S376P	probably damaging	Het

Other mutations in Casp8ap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00686:Casp8ap2	APN	4	32,641,433 (GRCm39)	missense	probably damaging	1.00
IGL00714:Casp8ap2	APN	4	32,649,192 (GRCm39)	missense	probably damaging	1.00
IGL00754:Casp8ap2	APN	4	32,641,036 (GRCm39)	missense	probably benign	0.00
IGL00954:Casp8ap2	APN	4	32,645,403 (GRCm39)	missense	probably damaging	1.00
IGL00970:Casp8ap2	APN	4	32,646,182 (GRCm39)	missense	probably benign
IGL01534:Casp8ap2	APN	4	32,648,134 (GRCm39)	splice site	probably benign
IGL01596:Casp8ap2	APN	4	32,646,365 (GRCm39)	missense	probably damaging	1.00
IGL01686:Casp8ap2	APN	4	32,641,294 (GRCm39)	missense	possibly damaging	0.94
IGL02002:Casp8ap2	APN	4	32,639,391 (GRCm39)	missense	probably damaging	1.00
IGL02273:Casp8ap2	APN	4	32,643,974 (GRCm39)	missense	probably damaging	1.00
IGL02510:Casp8ap2	APN	4	32,639,704 (GRCm39)	missense	probably benign	0.05
IGL02600:Casp8ap2	APN	4	32,630,246 (GRCm39)	missense	probably null	1.00
IGL02929:Casp8ap2	APN	4	32,624,105 (GRCm39)	utr 5 prime	probably benign
F5770:Casp8ap2	UTSW	4	32,639,944 (GRCm39)	missense	probably benign	0.00
IGL02988:Casp8ap2	UTSW	4	32,644,590 (GRCm39)	missense	probably benign	0.14
R0023:Casp8ap2	UTSW	4	32,640,185 (GRCm39)	missense	probably damaging	0.99
R0027:Casp8ap2	UTSW	4	32,643,810 (GRCm39)	missense	probably benign	0.01
R0090:Casp8ap2	UTSW	4	32,640,327 (GRCm39)	missense	probably damaging	1.00
R0117:Casp8ap2	UTSW	4	32,640,817 (GRCm39)	missense	probably benign	0.00
R0144:Casp8ap2	UTSW	4	32,643,797 (GRCm39)	missense	possibly damaging	0.50
R0268:Casp8ap2	UTSW	4	32,644,079 (GRCm39)	missense	probably damaging	0.99
R0344:Casp8ap2	UTSW	4	32,644,079 (GRCm39)	missense	probably damaging	0.99
R0555:Casp8ap2	UTSW	4	32,640,381 (GRCm39)	missense	probably damaging	1.00
R1051:Casp8ap2	UTSW	4	32,640,790 (GRCm39)	missense	probably benign	0.28
R1165:Casp8ap2	UTSW	4	32,640,563 (GRCm39)	missense	probably benign	0.01
R1243:Casp8ap2	UTSW	4	32,645,687 (GRCm39)	missense	probably benign	0.03
R1311:Casp8ap2	UTSW	4	32,648,111 (GRCm39)	missense	probably damaging	0.98
R1471:Casp8ap2	UTSW	4	32,639,386 (GRCm39)	nonsense	probably null
R1497:Casp8ap2	UTSW	4	32,639,938 (GRCm39)	missense	probably benign	0.00
R1521:Casp8ap2	UTSW	4	32,631,867 (GRCm39)	missense	probably damaging	1.00
R1588:Casp8ap2	UTSW	4	32,640,541 (GRCm39)	missense	probably benign	0.00
R1625:Casp8ap2	UTSW	4	32,648,068 (GRCm39)	missense	probably benign	0.04
R1731:Casp8ap2	UTSW	4	32,641,442 (GRCm39)	missense	possibly damaging	0.94
R1899:Casp8ap2	UTSW	4	32,643,647 (GRCm39)	missense	probably damaging	0.98
R2000:Casp8ap2	UTSW	4	32,634,874 (GRCm39)	missense	probably damaging	1.00
R2021:Casp8ap2	UTSW	4	32,644,560 (GRCm39)	missense	probably benign	0.05
R2022:Casp8ap2	UTSW	4	32,644,560 (GRCm39)	missense	probably benign	0.05
R2023:Casp8ap2	UTSW	4	32,644,560 (GRCm39)	missense	probably benign	0.05
R2088:Casp8ap2	UTSW	4	32,631,126 (GRCm39)	missense	probably damaging	1.00
R2104:Casp8ap2	UTSW	4	32,644,727 (GRCm39)	missense	probably benign	0.00
R2128:Casp8ap2	UTSW	4	32,640,142 (GRCm39)	missense	probably benign	0.06
R2129:Casp8ap2	UTSW	4	32,640,142 (GRCm39)	missense	probably benign	0.06
R2305:Casp8ap2	UTSW	4	32,646,411 (GRCm39)	missense	probably damaging	1.00
R2316:Casp8ap2	UTSW	4	32,643,781 (GRCm39)	missense	probably benign	0.31
R2919:Casp8ap2	UTSW	4	32,645,343 (GRCm39)	missense	probably damaging	1.00
R4091:Casp8ap2	UTSW	4	32,643,611 (GRCm39)	missense	probably damaging	1.00
R4357:Casp8ap2	UTSW	4	32,646,150 (GRCm39)	missense	probably benign	0.00
R4807:Casp8ap2	UTSW	4	32,644,505 (GRCm39)	missense	possibly damaging	0.89
R4828:Casp8ap2	UTSW	4	32,639,807 (GRCm39)	missense	probably benign
R4908:Casp8ap2	UTSW	4	32,639,905 (GRCm39)	missense	possibly damaging	0.90
R4945:Casp8ap2	UTSW	4	32,631,163 (GRCm39)	missense	possibly damaging	0.57
R4962:Casp8ap2	UTSW	4	32,640,554 (GRCm39)	missense	probably damaging	0.99
R6014:Casp8ap2	UTSW	4	32,641,400 (GRCm39)	missense	probably damaging	0.97
R6092:Casp8ap2	UTSW	4	32,639,380 (GRCm39)	missense	probably damaging	1.00
R6257:Casp8ap2	UTSW	4	32,641,364 (GRCm39)	missense	possibly damaging	0.94
R6289:Casp8ap2	UTSW	4	32,639,590 (GRCm39)	missense	probably damaging	1.00
R6482:Casp8ap2	UTSW	4	32,634,813 (GRCm39)	missense	probably damaging	1.00
R6496:Casp8ap2	UTSW	4	32,641,553 (GRCm39)	missense	probably benign	0.05
R6515:Casp8ap2	UTSW	4	32,646,423 (GRCm39)	missense	possibly damaging	0.64
R7015:Casp8ap2	UTSW	4	32,644,278 (GRCm39)	missense	probably damaging	1.00
R7033:Casp8ap2	UTSW	4	32,639,392 (GRCm39)	missense	probably damaging	1.00
R7072:Casp8ap2	UTSW	4	32,644,766 (GRCm39)	missense	probably damaging	1.00
R7448:Casp8ap2	UTSW	4	32,643,974 (GRCm39)	missense	possibly damaging	0.84
R7944:Casp8ap2	UTSW	4	32,645,909 (GRCm39)	missense	probably benign	0.12
R7945:Casp8ap2	UTSW	4	32,645,909 (GRCm39)	missense	probably benign	0.12
R8170:Casp8ap2	UTSW	4	32,615,490 (GRCm39)	splice site	probably benign
R8179:Casp8ap2	UTSW	4	32,643,939 (GRCm39)	nonsense	probably null
R8207:Casp8ap2	UTSW	4	32,646,446 (GRCm39)	missense	possibly damaging	0.63
R8263:Casp8ap2	UTSW	4	32,644,072 (GRCm39)	missense	probably damaging	1.00
R8298:Casp8ap2	UTSW	4	32,640,429 (GRCm39)	missense	probably benign	0.30
R9441:Casp8ap2	UTSW	4	32,645,873 (GRCm39)	missense	probably benign	0.00
R9455:Casp8ap2	UTSW	4	32,643,924 (GRCm39)	missense	possibly damaging	0.85
R9729:Casp8ap2	UTSW	4	32,643,807 (GRCm39)	missense	possibly damaging	0.71
V7580:Casp8ap2	UTSW	4	32,639,944 (GRCm39)	missense	probably benign	0.00
X0018:Casp8ap2	UTSW	4	32,643,738 (GRCm39)	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TACGGCGTGCAACACCATCTAC -3'
(R):5'- AAAGGACTGTTTGCCCTTCCCATC -3'

Sequencing Primer
(F):5'- CCCTGGCCTTAAACATGGTG -3'
(R):5'- CTCACTTGAAGCATCATGTGTC -3'

Posted On

2014-02-11