Incidental Mutation 'R1337:Hapln3'
ID156904
Institutional Source Beutler Lab
Gene Symbol Hapln3
Ensembl Gene ENSMUSG00000030606
Gene Namehyaluronan and proteoglycan link protein 3
SynonymsLpr3, 4930554N11Rik
MMRRC Submission 039402-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1337 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location79115102-79131018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79118076 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 190 (E190G)
Ref Sequence ENSEMBL: ENSMUSP00000146090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032827] [ENSMUST00000032835] [ENSMUST00000205782] [ENSMUST00000206092]
Predicted Effect probably benign
Transcript: ENSMUST00000032827
AA Change: S109G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000032827
Gene: ENSMUSG00000030606
AA Change: S109G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IGv 65 148 3.28e-8 SMART
LINK 164 261 1.78e-46 SMART
LINK 265 357 3.14e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032835
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205782
AA Change: E190G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000206092
AA Change: E190G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206402
Predicted Effect probably benign
Transcript: ENSMUST00000206779
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the hyaluronan and proteoglycan binding link protein gene family. The protein encoded by this gene may function in hyaluronic acid binding and cell adhesion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730522E02Rik A G 11: 25,769,033 S37P unknown Het
Abca12 T C 1: 71,294,819 I1175V probably benign Het
Ager G T 17: 34,600,622 probably null Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Cacna1c A G 6: 118,627,455 I1278T probably damaging Het
Casp8ap2 T C 4: 32,645,721 V1598A possibly damaging Het
Cdk12 T C 11: 98,245,671 probably null Het
Ces2g A T 8: 104,963,965 Y126F possibly damaging Het
Ehbp1l1 A T 19: 5,718,230 M1015K probably benign Het
Engase A G 11: 118,482,574 T248A possibly damaging Het
Gsdma C T 11: 98,669,707 Q162* probably null Het
Hdc T C 2: 126,616,276 Q42R probably benign Het
Larp1b C T 3: 41,033,402 P20S probably damaging Het
Macf1 T G 4: 123,476,275 R1564S probably benign Het
Muc5b A G 7: 141,858,624 Y1769C unknown Het
Nup88 T A 11: 70,944,890 Q576L probably damaging Het
Olfr566 T C 7: 102,856,871 N137S probably benign Het
Olfr836 A G 9: 19,121,803 I280V probably benign Het
Prune2 C T 19: 17,119,607 S825L possibly damaging Het
Ryr3 C A 2: 112,779,963 M2301I possibly damaging Het
Sdk2 A C 11: 113,832,331 V1278G possibly damaging Het
Sertad3 T C 7: 27,476,441 L100P probably damaging Het
Slco5a1 T C 1: 12,939,142 T370A probably benign Het
Srrm1 A G 4: 135,346,733 probably null Het
Stk32a A G 18: 43,261,349 D121G probably benign Het
Ttc7 A T 17: 87,290,296 R99W probably damaging Het
Xkr9 C A 1: 13,701,124 S288Y possibly damaging Het
Zfp644 A G 5: 106,637,554 S376P probably damaging Het
Other mutations in Hapln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Hapln3 APN 7 79121983 missense probably damaging 1.00
IGL01412:Hapln3 APN 7 79117436 intron probably null
IGL02141:Hapln3 APN 7 79118145 missense probably damaging 0.99
IGL02675:Hapln3 APN 7 79117848 critical splice donor site probably null
IGL02864:Hapln3 APN 7 79118064 missense probably benign 0.03
IGL02894:Hapln3 APN 7 79121773 missense probably benign 0.03
R1271:Hapln3 UTSW 7 79118016 missense probably damaging 1.00
R1351:Hapln3 UTSW 7 79121960 missense probably damaging 1.00
R1686:Hapln3 UTSW 7 79121890 missense probably benign 0.13
R1718:Hapln3 UTSW 7 79123450 missense unknown
R3103:Hapln3 UTSW 7 79121736 missense probably benign 0.07
R5625:Hapln3 UTSW 7 79117258 unclassified probably null
R5669:Hapln3 UTSW 7 79117496 splice site probably null
R5862:Hapln3 UTSW 7 79121891 missense possibly damaging 0.84
R5875:Hapln3 UTSW 7 79121973 missense probably benign 0.03
R7129:Hapln3 UTSW 7 79121824 missense not run
Predicted Primers PCR Primer
(F):5'- TTTTACTGAGCACCTACCACATGCC -3'
(R):5'- GCCAGCAGAATCTGTGTTTTGGACG -3'

Sequencing Primer
(F):5'- GCCAGCAGATGCTTTTTAAACC -3'
(R):5'- GGACGCACGTAGATCTTGG -3'
Posted On2014-02-11