Incidental Mutation 'R1337:Ces2g'
ID156907
Institutional Source Beutler Lab
Gene Symbol Ces2g
Ensembl Gene ENSMUSG00000031877
Gene Namecarboxylesterase 2G
Synonyms2210023G05Rik
MMRRC Submission 039402-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.043) question?
Stock #R1337 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location104961718-104969537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104963965 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 126 (Y126F)
Ref Sequence ENSEMBL: ENSMUSP00000049315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043183] [ENSMUST00000212820]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043183
AA Change: Y126F

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049315
Gene: ENSMUSG00000031877
AA Change: Y126F

DomainStartEndE-ValueType
Pfam:COesterase 11 539 1.4e-176 PFAM
Pfam:Abhydrolase_3 144 245 4.9e-11 PFAM
Pfam:Peptidase_S9 159 331 8.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212330
Predicted Effect probably benign
Transcript: ENSMUST00000212820
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730522E02Rik A G 11: 25,769,033 S37P unknown Het
Abca12 T C 1: 71,294,819 I1175V probably benign Het
Ager G T 17: 34,600,622 probably null Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Cacna1c A G 6: 118,627,455 I1278T probably damaging Het
Casp8ap2 T C 4: 32,645,721 V1598A possibly damaging Het
Cdk12 T C 11: 98,245,671 probably null Het
Ehbp1l1 A T 19: 5,718,230 M1015K probably benign Het
Engase A G 11: 118,482,574 T248A possibly damaging Het
Gsdma C T 11: 98,669,707 Q162* probably null Het
Hapln3 T C 7: 79,118,076 E190G probably benign Het
Hdc T C 2: 126,616,276 Q42R probably benign Het
Larp1b C T 3: 41,033,402 P20S probably damaging Het
Macf1 T G 4: 123,476,275 R1564S probably benign Het
Muc5b A G 7: 141,858,624 Y1769C unknown Het
Nup88 T A 11: 70,944,890 Q576L probably damaging Het
Olfr566 T C 7: 102,856,871 N137S probably benign Het
Olfr836 A G 9: 19,121,803 I280V probably benign Het
Prune2 C T 19: 17,119,607 S825L possibly damaging Het
Ryr3 C A 2: 112,779,963 M2301I possibly damaging Het
Sdk2 A C 11: 113,832,331 V1278G possibly damaging Het
Sertad3 T C 7: 27,476,441 L100P probably damaging Het
Slco5a1 T C 1: 12,939,142 T370A probably benign Het
Srrm1 A G 4: 135,346,733 probably null Het
Stk32a A G 18: 43,261,349 D121G probably benign Het
Ttc7 A T 17: 87,290,296 R99W probably damaging Het
Xkr9 C A 1: 13,701,124 S288Y possibly damaging Het
Zfp644 A G 5: 106,637,554 S376P probably damaging Het
Other mutations in Ces2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Ces2g APN 8 104967839 splice site probably benign
IGL00901:Ces2g APN 8 104965129 missense probably benign 0.01
IGL02101:Ces2g APN 8 104965137 splice site probably null
IGL02146:Ces2g APN 8 104966944 missense possibly damaging 0.94
IGL02624:Ces2g APN 8 104964748 missense probably damaging 1.00
IGL03091:Ces2g APN 8 104964754 missense probably damaging 1.00
R0025:Ces2g UTSW 8 104965996 splice site probably benign
R0025:Ces2g UTSW 8 104965996 splice site probably benign
R0122:Ces2g UTSW 8 104968300 missense probably damaging 0.96
R0494:Ces2g UTSW 8 104966567 missense probably benign
R1127:Ces2g UTSW 8 104967462 splice site probably null
R1619:Ces2g UTSW 8 104967352 missense probably damaging 1.00
R1813:Ces2g UTSW 8 104966937 missense probably benign 0.32
R2240:Ces2g UTSW 8 104962502 missense probably benign 0.11
R2255:Ces2g UTSW 8 104967414 missense probably damaging 1.00
R2307:Ces2g UTSW 8 104968412 missense probably benign 0.01
R2566:Ces2g UTSW 8 104965989 critical splice donor site probably null
R4026:Ces2g UTSW 8 104964745 missense probably damaging 0.99
R4469:Ces2g UTSW 8 104965970 missense probably benign 0.14
R4631:Ces2g UTSW 8 104967462 splice site probably null
R4859:Ces2g UTSW 8 104967462 splice site probably null
R4900:Ces2g UTSW 8 104967357 nonsense probably null
R4925:Ces2g UTSW 8 104964894 missense probably benign 0.27
R5524:Ces2g UTSW 8 104966895 missense probably benign 0.00
R5556:Ces2g UTSW 8 104967442 missense probably benign 0.14
R6795:Ces2g UTSW 8 104967817 missense probably damaging 0.96
R6988:Ces2g UTSW 8 104963908 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGGGCATCTATGACAAGCAGC -3'
(R):5'- GGTTCCAACTGCATTGTGTGGC -3'

Sequencing Primer
(F):5'- GCATCTATGACAAGCAGCTAAAG -3'
(R):5'- AGATGGCCTTCTTTGACCTAAG -3'
Posted On2014-02-11