Incidental Mutation 'R1337:Olfr836'
ID156908
Institutional Source Beutler Lab
Gene Symbol Olfr836
Ensembl Gene ENSMUSG00000059303
Gene Nameolfactory receptor 836
SynonymsMOR152-3, GA_x6K02T2PVTD-12857805-12858749
MMRRC Submission 039402-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R1337 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location19120382-19125938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19121803 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 280 (I280V)
Ref Sequence ENSEMBL: ENSMUSP00000150026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074986] [ENSMUST00000212730] [ENSMUST00000215981]
Predicted Effect probably benign
Transcript: ENSMUST00000074986
AA Change: I283V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074514
Gene: ENSMUSG00000059303
AA Change: I283V

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.2e-50 PFAM
Pfam:7TM_GPCR_Srsx 38 210 9.6e-6 PFAM
Pfam:7tm_1 44 293 2.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212730
AA Change: I280V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215981
AA Change: I280V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730522E02Rik A G 11: 25,769,033 S37P unknown Het
Abca12 T C 1: 71,294,819 I1175V probably benign Het
Ager G T 17: 34,600,622 probably null Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Cacna1c A G 6: 118,627,455 I1278T probably damaging Het
Casp8ap2 T C 4: 32,645,721 V1598A possibly damaging Het
Cdk12 T C 11: 98,245,671 probably null Het
Ces2g A T 8: 104,963,965 Y126F possibly damaging Het
Ehbp1l1 A T 19: 5,718,230 M1015K probably benign Het
Engase A G 11: 118,482,574 T248A possibly damaging Het
Gsdma C T 11: 98,669,707 Q162* probably null Het
Hapln3 T C 7: 79,118,076 E190G probably benign Het
Hdc T C 2: 126,616,276 Q42R probably benign Het
Larp1b C T 3: 41,033,402 P20S probably damaging Het
Macf1 T G 4: 123,476,275 R1564S probably benign Het
Muc5b A G 7: 141,858,624 Y1769C unknown Het
Nup88 T A 11: 70,944,890 Q576L probably damaging Het
Olfr566 T C 7: 102,856,871 N137S probably benign Het
Prune2 C T 19: 17,119,607 S825L possibly damaging Het
Ryr3 C A 2: 112,779,963 M2301I possibly damaging Het
Sdk2 A C 11: 113,832,331 V1278G possibly damaging Het
Sertad3 T C 7: 27,476,441 L100P probably damaging Het
Slco5a1 T C 1: 12,939,142 T370A probably benign Het
Srrm1 A G 4: 135,346,733 probably null Het
Stk32a A G 18: 43,261,349 D121G probably benign Het
Ttc7 A T 17: 87,290,296 R99W probably damaging Het
Xkr9 C A 1: 13,701,124 S288Y possibly damaging Het
Zfp644 A G 5: 106,637,554 S376P probably damaging Het
Other mutations in Olfr836
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Olfr836 APN 9 19121232 missense possibly damaging 0.88
IGL01316:Olfr836 APN 9 19121422 missense probably benign 0.10
IGL01412:Olfr836 APN 9 19121599 missense probably benign 0.00
IGL01815:Olfr836 APN 9 19121326 missense probably damaging 1.00
IGL02003:Olfr836 APN 9 19121065 missense probably benign 0.06
IGL02313:Olfr836 APN 9 19121375 missense probably damaging 0.99
IGL03185:Olfr836 APN 9 19121738 missense probably damaging 1.00
IGL03186:Olfr836 APN 9 19121904 missense probably benign 0.16
R2267:Olfr836 UTSW 9 19121441 missense probably benign 0.22
R3969:Olfr836 UTSW 9 19121660 missense probably benign 0.00
R4695:Olfr836 UTSW 9 19121010 missense probably null 0.04
R4976:Olfr836 UTSW 9 19121501 missense probably damaging 1.00
R5176:Olfr836 UTSW 9 19121360 missense probably damaging 1.00
R5379:Olfr836 UTSW 9 19121077 missense probably damaging 1.00
R5638:Olfr836 UTSW 9 19121380 missense probably benign 0.00
R6084:Olfr836 UTSW 9 19121327 missense probably damaging 1.00
R6236:Olfr836 UTSW 9 19121113 missense possibly damaging 0.92
R6329:Olfr836 UTSW 9 19120957 start codon destroyed probably benign 0.08
R7151:Olfr836 UTSW 9 19121741 missense not run
Predicted Primers PCR Primer
(F):5'- GCCTGTTCTGACAGCCTAATCAACAA -3'
(R):5'- ACTACCAGAGGTTCTACTCAAGAGGTTC -3'

Sequencing Primer
(F):5'- TGACAGCCTAATCAACAACATCTTG -3'
(R):5'- cctaaagtcaatcccaacccc -3'
Posted On2014-02-11