Incidental Mutation 'R1337:Gsdma'
ID156912
Institutional Source Beutler Lab
Gene Symbol Gsdma
Ensembl Gene ENSMUSG00000017204
Gene Namegasdermin A
SynonymsGsdm1, H312E, Gsdm, Gsdma1
MMRRC Submission 039402-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.042) question?
Stock #R1337 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98664351-98677708 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 98669707 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 162 (Q162*)
Ref Sequence ENSEMBL: ENSMUSP00000017348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017348]
Predicted Effect probably null
Transcript: ENSMUST00000017348
AA Change: Q162*
SMART Domains Protein: ENSMUSP00000017348
Gene: ENSMUSG00000017204
AA Change: Q162*

DomainStartEndE-ValueType
Pfam:Gasdermin 3 421 2.2e-147 PFAM
low complexity region 429 443 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730522E02Rik A G 11: 25,769,033 S37P unknown Het
Abca12 T C 1: 71,294,819 I1175V probably benign Het
Ager G T 17: 34,600,622 probably null Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Cacna1c A G 6: 118,627,455 I1278T probably damaging Het
Casp8ap2 T C 4: 32,645,721 V1598A possibly damaging Het
Cdk12 T C 11: 98,245,671 probably null Het
Ces2g A T 8: 104,963,965 Y126F possibly damaging Het
Ehbp1l1 A T 19: 5,718,230 M1015K probably benign Het
Engase A G 11: 118,482,574 T248A possibly damaging Het
Hapln3 T C 7: 79,118,076 E190G probably benign Het
Hdc T C 2: 126,616,276 Q42R probably benign Het
Larp1b C T 3: 41,033,402 P20S probably damaging Het
Macf1 T G 4: 123,476,275 R1564S probably benign Het
Muc5b A G 7: 141,858,624 Y1769C unknown Het
Nup88 T A 11: 70,944,890 Q576L probably damaging Het
Olfr566 T C 7: 102,856,871 N137S probably benign Het
Olfr836 A G 9: 19,121,803 I280V probably benign Het
Prune2 C T 19: 17,119,607 S825L possibly damaging Het
Ryr3 C A 2: 112,779,963 M2301I possibly damaging Het
Sdk2 A C 11: 113,832,331 V1278G possibly damaging Het
Sertad3 T C 7: 27,476,441 L100P probably damaging Het
Slco5a1 T C 1: 12,939,142 T370A probably benign Het
Srrm1 A G 4: 135,346,733 probably null Het
Stk32a A G 18: 43,261,349 D121G probably benign Het
Ttc7 A T 17: 87,290,296 R99W probably damaging Het
Xkr9 C A 1: 13,701,124 S288Y possibly damaging Het
Zfp644 A G 5: 106,637,554 S376P probably damaging Het
Other mutations in Gsdma
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Gsdma APN 11 98673687 missense probably damaging 0.98
IGL02573:Gsdma APN 11 98670751 splice site probably benign
IGL03005:Gsdma APN 11 98676259 missense probably damaging 0.97
R0143:Gsdma UTSW 11 98666254 missense probably damaging 0.96
R1533:Gsdma UTSW 11 98676384 missense unknown
R1605:Gsdma UTSW 11 98666493 missense probably damaging 0.98
R1929:Gsdma UTSW 11 98671367 critical splice donor site probably null
R1998:Gsdma UTSW 11 98673694 missense probably damaging 0.99
R2043:Gsdma UTSW 11 98666220 missense possibly damaging 0.94
R2114:Gsdma UTSW 11 98673012 missense probably damaging 1.00
R3404:Gsdma UTSW 11 98673138 splice site probably benign
R3405:Gsdma UTSW 11 98673138 splice site probably benign
R3406:Gsdma UTSW 11 98673138 splice site probably benign
R3711:Gsdma UTSW 11 98666219 nonsense probably null
R3764:Gsdma UTSW 11 98670767 missense probably damaging 0.98
R4656:Gsdma UTSW 11 98673081 missense probably damaging 1.00
R5384:Gsdma UTSW 11 98666449 critical splice acceptor site probably null
R5943:Gsdma UTSW 11 98673026 missense probably benign 0.30
X0017:Gsdma UTSW 11 98666270 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- ATAGTACAAAGCACAGGTGGTGGCCC -3'
(R):5'- ACATTCTGAAAGCAGGAAACTGCCCTC -3'

Sequencing Primer
(F):5'- CCCTGGAGAGGAAATGCTG -3'
(R):5'- actctcctgcctctgcc -3'
Posted On2014-02-11