Incidental Mutation 'R1337:Ager'
ID156919
Institutional Source Beutler Lab
Gene Symbol Ager
Ensembl Gene ENSMUSG00000015452
Gene Nameadvanced glycosylation end product-specific receptor
SynonymsRAGE
MMRRC Submission 039402-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R1337 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34597862-34600936 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 34600622 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015596] [ENSMUST00000015622] [ENSMUST00000038149] [ENSMUST00000173242] [ENSMUST00000173328] [ENSMUST00000173992] [ENSMUST00000174041] [ENSMUST00000174069] [ENSMUST00000174496] [ENSMUST00000183827]
Predicted Effect probably null
Transcript: ENSMUST00000015596
SMART Domains Protein: ENSMUSP00000015596
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 4.3e-24 PFAM
IGc2 248 306 7.63e-18 SMART
transmembrane domain 339 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000015622
SMART Domains Protein: ENSMUSP00000015622
Gene: ENSMUSG00000015478

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
RING 27 67 1.5e-8 SMART
transmembrane domain 118 140 N/A INTRINSIC
transmembrane domain 160 179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038149
SMART Domains Protein: ENSMUSP00000040464
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
low complexity region 7 49 N/A INTRINSIC
Pfam:PBC 50 243 1.3e-97 PFAM
HOX 244 309 1.9e-18 SMART
low complexity region 327 353 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172932
SMART Domains Protein: ENSMUSP00000133660
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173229
Predicted Effect probably benign
Transcript: ENSMUST00000173242
SMART Domains Protein: ENSMUSP00000134242
Gene: ENSMUSG00000034254

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 66 71 N/A INTRINSIC
Pfam:Acyltransferase 80 149 1.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173328
SMART Domains Protein: ENSMUSP00000133766
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
Pfam:PBC 1 161 5e-84 PFAM
HOX 162 227 1.9e-18 SMART
low complexity region 245 271 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173589
SMART Domains Protein: ENSMUSP00000133845
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173992
SMART Domains Protein: ENSMUSP00000134579
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
IG 23 108 3.23e-7 SMART
Pfam:C2-set_2 114 208 3.3e-24 PFAM
IGc2 239 297 7.63e-18 SMART
transmembrane domain 321 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174041
SMART Domains Protein: ENSMUSP00000133441
Gene: ENSMUSG00000034254

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 66 71 N/A INTRINSIC
PlsC 95 198 6.63e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174045
Predicted Effect probably benign
Transcript: ENSMUST00000174069
SMART Domains Protein: ENSMUSP00000133391
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 2.5e-24 PFAM
IGc2 248 306 7.63e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174475
Predicted Effect probably null
Transcript: ENSMUST00000174496
SMART Domains Protein: ENSMUSP00000134401
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 3.4e-24 PFAM
IGc2 248 306 7.63e-18 SMART
transmembrane domain 330 352 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174756
Predicted Effect probably benign
Transcript: ENSMUST00000183827
SMART Domains Protein: ENSMUSP00000139079
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
Pfam:PBC 1 183 9.5e-98 PFAM
HOX 184 249 1.9e-18 SMART
low complexity region 267 293 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184846
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The advanced glycosylation end product (AGE) receptor encoded by this gene is a member of the immunoglobulin superfamily of cell surface receptors. It is a multiligand receptor, and besides AGE, interacts with other molecules implicated in homeostasis, development, and inflammation, and certain diseases, such as diabetes and Alzheimer's disease. Many alternatively spliced transcript variants encoding different isoforms, as well as non-protein-coding variants, have been described for this gene (PMID:18089847). [provided by RefSeq, May 2011]
PHENOTYPE: Homozygotes for a null allele show increased bone mass and strength, reduced osteoclast number, abnormal blood vessel healing, and altered development of nephropathy and pain perception in induced diabetes. Homozygotes for another null allele show restored diabetes-induced angiogenic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730522E02Rik A G 11: 25,769,033 S37P unknown Het
Abca12 T C 1: 71,294,819 I1175V probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Cacna1c A G 6: 118,627,455 I1278T probably damaging Het
Casp8ap2 T C 4: 32,645,721 V1598A possibly damaging Het
Cdk12 T C 11: 98,245,671 probably null Het
Ces2g A T 8: 104,963,965 Y126F possibly damaging Het
Ehbp1l1 A T 19: 5,718,230 M1015K probably benign Het
Engase A G 11: 118,482,574 T248A possibly damaging Het
Gsdma C T 11: 98,669,707 Q162* probably null Het
Hapln3 T C 7: 79,118,076 E190G probably benign Het
Hdc T C 2: 126,616,276 Q42R probably benign Het
Larp1b C T 3: 41,033,402 P20S probably damaging Het
Macf1 T G 4: 123,476,275 R1564S probably benign Het
Muc5b A G 7: 141,858,624 Y1769C unknown Het
Nup88 T A 11: 70,944,890 Q576L probably damaging Het
Olfr566 T C 7: 102,856,871 N137S probably benign Het
Olfr836 A G 9: 19,121,803 I280V probably benign Het
Prune2 C T 19: 17,119,607 S825L possibly damaging Het
Ryr3 C A 2: 112,779,963 M2301I possibly damaging Het
Sdk2 A C 11: 113,832,331 V1278G possibly damaging Het
Sertad3 T C 7: 27,476,441 L100P probably damaging Het
Slco5a1 T C 1: 12,939,142 T370A probably benign Het
Srrm1 A G 4: 135,346,733 probably null Het
Stk32a A G 18: 43,261,349 D121G probably benign Het
Ttc7 A T 17: 87,290,296 R99W probably damaging Het
Xkr9 C A 1: 13,701,124 S288Y possibly damaging Het
Zfp644 A G 5: 106,637,554 S376P probably damaging Het
Other mutations in Ager
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01808:Ager APN 17 34599457 missense probably damaging 0.97
IGL02143:Ager APN 17 34599118 missense probably damaging 1.00
IGL02219:Ager APN 17 34600120 missense probably damaging 0.97
R1584:Ager UTSW 17 34600718 missense probably damaging 1.00
R2269:Ager UTSW 17 34599150 missense probably damaging 1.00
R5804:Ager UTSW 17 34598183 missense probably damaging 0.98
R5881:Ager UTSW 17 34600077 missense probably damaging 1.00
R5939:Ager UTSW 17 34598201 missense probably damaging 1.00
R6276:Ager UTSW 17 34598754 missense possibly damaging 0.86
R6551:Ager UTSW 17 34599468 unclassified probably null
R7009:Ager UTSW 17 34600736 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCCAGCTTTTCCACTAACTGAGG -3'
(R):5'- CGGCAACACACCGTGTCAAATG -3'

Sequencing Primer
(F):5'- TTCCACTAACTGAGGGGAATTGC -3'
(R):5'- ATCACACAGGCTCGATCTGG -3'
Posted On2014-02-11