Incidental Mutation 'R1337:Stk32a'
List |< first << previous [record 26 of 29] next >> last >|
Institutional Source Beutler Lab
Gene Symbol Stk32a
Ensembl Gene ENSMUSG00000039954
Gene Nameserine/threonine kinase 32A
SynonymsYANK1, A930015B13Rik
MMRRC Submission 039402-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R1337 (G1)
Quality Score225
Status Not validated
Chromosomal Location43207697-43317481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43261349 bp
Amino Acid Change Aspartic acid to Glycine at position 121 (D121G)
Ref Sequence ENSEMBL: ENSMUSP00000038471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045477]
Predicted Effect probably benign
Transcript: ENSMUST00000045477
AA Change: D121G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000038471
Gene: ENSMUSG00000039954
AA Change: D121G

S_TKc 23 281 9.58e-85 SMART
low complexity region 318 339 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730522E02Rik A G 11: 25,769,033 S37P unknown Het
Abca12 T C 1: 71,294,819 I1175V probably benign Het
Ager G T 17: 34,600,622 probably null Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Cacna1c A G 6: 118,627,455 I1278T probably damaging Het
Casp8ap2 T C 4: 32,645,721 V1598A possibly damaging Het
Cdk12 T C 11: 98,245,671 probably null Het
Ces2g A T 8: 104,963,965 Y126F possibly damaging Het
Ehbp1l1 A T 19: 5,718,230 M1015K probably benign Het
Engase A G 11: 118,482,574 T248A possibly damaging Het
Gsdma C T 11: 98,669,707 Q162* probably null Het
Hapln3 T C 7: 79,118,076 E190G probably benign Het
Hdc T C 2: 126,616,276 Q42R probably benign Het
Larp1b C T 3: 41,033,402 P20S probably damaging Het
Macf1 T G 4: 123,476,275 R1564S probably benign Het
Muc5b A G 7: 141,858,624 Y1769C unknown Het
Nup88 T A 11: 70,944,890 Q576L probably damaging Het
Olfr566 T C 7: 102,856,871 N137S probably benign Het
Olfr836 A G 9: 19,121,803 I280V probably benign Het
Prune2 C T 19: 17,119,607 S825L possibly damaging Het
Ryr3 C A 2: 112,779,963 M2301I possibly damaging Het
Sdk2 A C 11: 113,832,331 V1278G possibly damaging Het
Sertad3 T C 7: 27,476,441 L100P probably damaging Het
Slco5a1 T C 1: 12,939,142 T370A probably benign Het
Srrm1 A G 4: 135,346,733 probably null Het
Ttc7 A T 17: 87,290,296 R99W probably damaging Het
Xkr9 C A 1: 13,701,124 S288Y possibly damaging Het
Zfp644 A G 5: 106,637,554 S376P probably damaging Het
Other mutations in Stk32a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Stk32a APN 18 43310445 missense possibly damaging 0.46
IGL00704:Stk32a APN 18 43261249 missense probably damaging 1.00
IGL00813:Stk32a APN 18 43310520 missense probably benign 0.10
IGL02121:Stk32a APN 18 43313507 missense probably benign
IGL02407:Stk32a APN 18 43297511 missense probably benign 0.00
IGL02957:Stk32a APN 18 43311992 missense probably benign
R0004:Stk32a UTSW 18 43305056 missense probably damaging 1.00
R0047:Stk32a UTSW 18 43313378 splice site probably benign
R0047:Stk32a UTSW 18 43313378 splice site probably benign
R0288:Stk32a UTSW 18 43304995 splice site probably null
R0330:Stk32a UTSW 18 43313501 missense probably benign 0.15
R1559:Stk32a UTSW 18 43243084 missense probably benign 0.32
R1695:Stk32a UTSW 18 43313420 nonsense probably null
R1874:Stk32a UTSW 18 43261316 missense probably damaging 1.00
R1954:Stk32a UTSW 18 43212025 missense probably benign 0.45
R4529:Stk32a UTSW 18 43242979 missense possibly damaging 0.83
R4980:Stk32a UTSW 18 43314048 missense probably benign 0.01
R5124:Stk32a UTSW 18 43305017 missense probably benign 0.00
R5751:Stk32a UTSW 18 43305020 missense possibly damaging 0.74
R5822:Stk32a UTSW 18 43313487 missense probably benign 0.00
R5863:Stk32a UTSW 18 43315144 missense probably benign 0.00
R6167:Stk32a UTSW 18 43313409 missense probably damaging 1.00
R6355:Stk32a UTSW 18 43297594 splice site probably null
R6731:Stk32a UTSW 18 43305078 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- atgtccccagatccgcc -3'
(R):5'- ggctgtggtgatgactaaatg -3'
Posted On2014-02-11