Incidental Mutation 'R1338:P2ry13'
ID156931
Institutional Source Beutler Lab
Gene Symbol P2ry13
Ensembl Gene ENSMUSG00000036362
Gene Namepurinergic receptor P2Y, G-protein coupled 13
SynonymsGpr86, 2010001L06Rik, SP174, P2Y13
MMRRC Submission 039403-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1338 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location59207892-59210882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59210289 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 23 (T23A)
Ref Sequence ENSEMBL: ENSMUSP00000044730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000040622] [ENSMUST00000164225] [ENSMUST00000199659]
Predicted Effect probably benign
Transcript: ENSMUST00000040325
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040622
AA Change: T23A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000044730
Gene: ENSMUSG00000036362
AA Change: T23A

DomainStartEndE-ValueType
Pfam:7tm_1 44 298 1.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164225
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199659
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is activated by ADP. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired bile flow, biliary cholesterol secretion, and bile acid secretion, decreased liver cholesterol level, and reduced macrophage-to-feces reverse cholesterol transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,052,535 H5005Y unknown Het
Akap12 G T 10: 4,313,773 V61F possibly damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ap4e1 T A 2: 127,046,909 D459E probably damaging Het
Brdt C A 5: 107,350,188 P243Q probably benign Het
C5ar1 A C 7: 16,248,335 F253L probably damaging Het
Cep104 T G 4: 153,994,508 V323G probably benign Het
Col11a1 A T 3: 114,216,995 probably benign Het
Fat3 T A 9: 15,925,091 Y4039F probably benign Het
Lmcd1 A C 6: 112,305,128 H41P probably damaging Het
Olfr466 T C 13: 65,152,383 L53P probably damaging Het
Pcdhb14 A T 18: 37,449,890 E683V probably benign Het
Pck1 G A 2: 173,158,410 E545K probably benign Het
Pkhd1l1 T C 15: 44,526,724 V1412A probably damaging Het
Rnf139 T C 15: 58,899,215 V363A probably damaging Het
Serpinh1 A G 7: 99,348,911 S171P probably damaging Het
Skint6 T C 4: 113,012,961 K600R possibly damaging Het
Slc7a1 C T 5: 148,345,936 E34K probably damaging Het
Spata31d1b AGGG AGG 13: 59,718,161 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Ttc6 A T 12: 57,616,369 N317I probably benign Het
Zan A T 5: 137,393,651 C4627* probably null Het
Zfhx4 T C 3: 5,396,961 V1232A possibly damaging Het
Other mutations in P2ry13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01815:P2ry13 APN 3 59209700 missense probably benign
IGL02370:P2ry13 APN 3 59209465 missense probably damaging 1.00
IGL02850:P2ry13 APN 3 59209608 missense probably damaging 0.99
IGL03160:P2ry13 APN 3 59210075 missense probably damaging 1.00
IGL03247:P2ry13 APN 3 59209592 missense possibly damaging 0.52
R0346:P2ry13 UTSW 3 59209566 missense possibly damaging 0.90
R1491:P2ry13 UTSW 3 59209518 missense probably damaging 1.00
R1528:P2ry13 UTSW 3 59210289 missense probably benign 0.03
R2265:P2ry13 UTSW 3 59210028 missense probably damaging 1.00
R2266:P2ry13 UTSW 3 59210028 missense probably damaging 1.00
R2267:P2ry13 UTSW 3 59210028 missense probably damaging 1.00
R2925:P2ry13 UTSW 3 59209380 missense probably benign 0.09
R4747:P2ry13 UTSW 3 59209887 missense probably benign 0.02
R4942:P2ry13 UTSW 3 59209562 missense probably benign 0.35
R5655:P2ry13 UTSW 3 59209839 missense possibly damaging 0.84
R5808:P2ry13 UTSW 3 59210232 missense probably benign 0.00
R5913:P2ry13 UTSW 3 59209365 missense probably benign 0.06
R6181:P2ry13 UTSW 3 59209907 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGTGCCATTATCAAGTCTGCCACC -3'
(R):5'- TGTCACCGCCGTGTAGTGATTG -3'

Sequencing Primer
(F):5'- TTATCAAGTCTGCCACCAGAGTG -3'
(R):5'- acaaaaaccaaccaaacaacaac -3'
Posted On2014-02-11