Incidental Mutation 'R1338:Col11a1'
ID156932
Institutional Source Beutler Lab
Gene Symbol Col11a1
Ensembl Gene ENSMUSG00000027966
Gene Namecollagen, type XI, alpha 1
SynonymsC530001D20Rik
MMRRC Submission 039403-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R1338 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location114030540-114220718 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to T at 114216995 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092155] [ENSMUST00000184978]
Predicted Effect unknown
Transcript: ENSMUST00000092155
AA Change: N1687Y
SMART Domains Protein: ENSMUSP00000089793
Gene: ENSMUSG00000027966
AA Change: N1687Y

DomainStartEndE-ValueType
TSPN 37 228 1.83e-62 SMART
LamG 96 227 5.87e-11 SMART
low complexity region 256 276 N/A INTRINSIC
internal_repeat_4 357 431 3.12e-6 PROSPERO
Pfam:Collagen 433 491 2.6e-9 PFAM
Pfam:Collagen 525 586 5.9e-9 PFAM
low complexity region 611 632 N/A INTRINSIC
low complexity region 638 677 N/A INTRINSIC
Pfam:Collagen 721 805 3.6e-8 PFAM
internal_repeat_3 814 854 3.55e-9 PROSPERO
internal_repeat_1 818 869 2.01e-16 PROSPERO
low complexity region 872 944 N/A INTRINSIC
low complexity region 952 1001 N/A INTRINSIC
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1066 1100 N/A INTRINSIC
low complexity region 1103 1121 N/A INTRINSIC
internal_repeat_2 1124 1188 2.4e-12 PROSPERO
low complexity region 1189 1205 N/A INTRINSIC
low complexity region 1211 1232 N/A INTRINSIC
low complexity region 1235 1250 N/A INTRINSIC
low complexity region 1252 1368 N/A INTRINSIC
low complexity region 1373 1392 N/A INTRINSIC
low complexity region 1417 1448 N/A INTRINSIC
low complexity region 1453 1463 N/A INTRINSIC
Pfam:Collagen 1481 1543 8.3e-9 PFAM
COLFI 1574 1803 7.28e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184978
SMART Domains Protein: ENSMUSP00000138879
Gene: ENSMUSG00000027966

DomainStartEndE-ValueType
Pfam:Collagen 1 57 6.3e-10 PFAM
Pfam:Collagen 49 110 3.2e-10 PFAM
Pfam:Collagen 95 165 6.2e-8 PFAM
Pfam:Collagen 242 318 2.2e-9 PFAM
Pfam:Collagen 289 362 1.6e-7 PFAM
Pfam:Collagen 341 403 2e-9 PFAM
COLFI 434 536 8.88e-12 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XI collagen, one of the low abundance fibrillar collagens that is essential for normal embryonic skeletal development and the cohesive properties of cartilage. The encoded protein, in association with the alpha-1 subunit of type II collagen, forms a heterotrimeric type XI procollagen that undergoes proteolytic processing. Mice lacking the encoded protein develop severe chondrodysplasia and die at birth. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality by asphyxia. Mutants animals display weak tracheal cartilage, short snout, short mandible, cleft palate, short limbs, and externally rotated distal portion of the hindlimbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,052,535 H5005Y unknown Het
Akap12 G T 10: 4,313,773 V61F possibly damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ap4e1 T A 2: 127,046,909 D459E probably damaging Het
Brdt C A 5: 107,350,188 P243Q probably benign Het
C5ar1 A C 7: 16,248,335 F253L probably damaging Het
Cep104 T G 4: 153,994,508 V323G probably benign Het
Fat3 T A 9: 15,925,091 Y4039F probably benign Het
Lmcd1 A C 6: 112,305,128 H41P probably damaging Het
Olfr466 T C 13: 65,152,383 L53P probably damaging Het
P2ry13 T C 3: 59,210,289 T23A probably benign Het
Pcdhb14 A T 18: 37,449,890 E683V probably benign Het
Pck1 G A 2: 173,158,410 E545K probably benign Het
Pkhd1l1 T C 15: 44,526,724 V1412A probably damaging Het
Rnf139 T C 15: 58,899,215 V363A probably damaging Het
Serpinh1 A G 7: 99,348,911 S171P probably damaging Het
Skint6 T C 4: 113,012,961 K600R possibly damaging Het
Slc7a1 C T 5: 148,345,936 E34K probably damaging Het
Spata31d1b AGGG AGG 13: 59,718,161 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Ttc6 A T 12: 57,616,369 N317I probably benign Het
Zan A T 5: 137,393,651 C4627* probably null Het
Zfhx4 T C 3: 5,396,961 V1232A possibly damaging Het
Other mutations in Col11a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Col11a1 APN 3 114066533 missense unknown
IGL00578:Col11a1 APN 3 114194106 missense possibly damaging 0.95
IGL00742:Col11a1 APN 3 114124315 missense unknown
IGL01014:Col11a1 APN 3 114123809 splice site probably benign
IGL01099:Col11a1 APN 3 114112041 nonsense probably null
IGL01129:Col11a1 APN 3 114185873 splice site probably benign
IGL01474:Col11a1 APN 3 114217134 utr 3 prime probably benign
IGL01884:Col11a1 APN 3 114066542 missense unknown
IGL02104:Col11a1 APN 3 114181397 critical splice donor site probably null
IGL02715:Col11a1 APN 3 114129409 missense probably benign 0.06
IGL02978:Col11a1 APN 3 114061562 missense unknown
IGL03203:Col11a1 APN 3 114212084 missense possibly damaging 0.91
IGL03240:Col11a1 APN 3 114217210 splice site probably null
IGL03357:Col11a1 APN 3 114194091 missense probably damaging 1.00
IGL03390:Col11a1 APN 3 114090253 missense unknown
gluon UTSW 3 114217170 utr 3 prime probably benign
R0110:Col11a1 UTSW 3 114105456 splice site probably benign
R0144:Col11a1 UTSW 3 114113594 missense unknown
R0432:Col11a1 UTSW 3 114205901 splice site probably benign
R0468:Col11a1 UTSW 3 114217058 utr 3 prime probably benign
R0510:Col11a1 UTSW 3 114105456 splice site probably benign
R0535:Col11a1 UTSW 3 114061535 missense unknown
R0608:Col11a1 UTSW 3 114218715 utr 3 prime probably benign
R0826:Col11a1 UTSW 3 114138765 missense unknown
R0827:Col11a1 UTSW 3 114138765 missense unknown
R0862:Col11a1 UTSW 3 114138765 missense unknown
R0863:Col11a1 UTSW 3 114138765 missense unknown
R0926:Col11a1 UTSW 3 114090180 missense unknown
R0980:Col11a1 UTSW 3 114138765 missense unknown
R0981:Col11a1 UTSW 3 114138765 missense unknown
R1004:Col11a1 UTSW 3 114095022 splice site probably benign
R1037:Col11a1 UTSW 3 114194152 missense probably damaging 1.00
R1171:Col11a1 UTSW 3 114066564 missense unknown
R1316:Col11a1 UTSW 3 114138970 splice site probably null
R1324:Col11a1 UTSW 3 114030916 missense unknown
R1513:Col11a1 UTSW 3 114097154 missense unknown
R1528:Col11a1 UTSW 3 114216995 utr 3 prime probably benign
R1567:Col11a1 UTSW 3 114138612 missense unknown
R1596:Col11a1 UTSW 3 114152613 utr 3 prime probably benign
R1605:Col11a1 UTSW 3 114131641 missense probably damaging 1.00
R1624:Col11a1 UTSW 3 114158155 missense probably damaging 0.97
R1626:Col11a1 UTSW 3 114131569 missense probably damaging 1.00
R1666:Col11a1 UTSW 3 114061535 missense unknown
R1806:Col11a1 UTSW 3 114158142 missense probably damaging 1.00
R2001:Col11a1 UTSW 3 114165293 splice site probably null
R2084:Col11a1 UTSW 3 114158142 missense probably damaging 1.00
R2085:Col11a1 UTSW 3 114158142 missense probably damaging 1.00
R3926:Col11a1 UTSW 3 114090124 splice site probably benign
R3950:Col11a1 UTSW 3 114121445 critical splice donor site probably null
R3970:Col11a1 UTSW 3 114097189 missense unknown
R4171:Col11a1 UTSW 3 114208214 missense probably damaging 0.99
R4175:Col11a1 UTSW 3 114208223 missense possibly damaging 0.83
R4176:Col11a1 UTSW 3 114208223 missense possibly damaging 0.83
R4413:Col11a1 UTSW 3 114108316 missense unknown
R4540:Col11a1 UTSW 3 114097166 missense unknown
R5210:Col11a1 UTSW 3 114153157 missense probably damaging 1.00
R5250:Col11a1 UTSW 3 114217170 utr 3 prime probably benign
R5335:Col11a1 UTSW 3 114095240 missense unknown
R5344:Col11a1 UTSW 3 114208362 critical splice donor site probably null
R5394:Col11a1 UTSW 3 114194184 splice site probably null
R5687:Col11a1 UTSW 3 114217103 utr 3 prime probably benign
R5708:Col11a1 UTSW 3 114097094 missense unknown
R5763:Col11a1 UTSW 3 114094596 intron probably benign
R5792:Col11a1 UTSW 3 114131593 missense probably damaging 1.00
R6259:Col11a1 UTSW 3 114138447 missense probably benign
R6679:Col11a1 UTSW 3 114152719 splice site probably null
R6738:Col11a1 UTSW 3 114112467 unclassified probably benign
R6808:Col11a1 UTSW 3 114094944 missense possibly damaging 0.87
R6861:Col11a1 UTSW 3 114167492 missense probably damaging 1.00
X0018:Col11a1 UTSW 3 114112233 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAAGCCCCTAACTATGGCCCTTTTG -3'
(R):5'- AAAGCAGGCTGAGACTGGACTCAC -3'

Sequencing Primer
(F):5'- AACTATGGCCCTTTTGACTCTTG -3'
(R):5'- GAGACTGGACTCACCGCAC -3'
Posted On2014-02-11