Incidental Mutation 'R1338:C5ar1'
ID156939
Institutional Source Beutler Lab
Gene Symbol C5ar1
Ensembl Gene ENSMUSG00000049130
Gene Namecomplement component 5a receptor 1
SynonymsC5aR, D7Msu1, Cd88, C5r1
MMRRC Submission 039403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1338 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location16246743-16259540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 16248335 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 253 (F253L)
Ref Sequence ENSEMBL: ENSMUSP00000129972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050770] [ENSMUST00000168818] [ENSMUST00000171425] [ENSMUST00000209442]
Predicted Effect probably damaging
Transcript: ENSMUST00000050770
AA Change: F253L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060003
Gene: ENSMUSG00000049130
AA Change: F253L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 48 312 2.2e-5 PFAM
Pfam:7tm_1 54 301 9.4e-41 PFAM
low complexity region 332 348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168818
AA Change: F253L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129972
Gene: ENSMUSG00000049130
AA Change: F253L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 48 312 2e-5 PFAM
Pfam:7tm_1 54 301 9.2e-52 PFAM
low complexity region 332 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171425
SMART Domains Protein: ENSMUSP00000133056
Gene: ENSMUSG00000074361

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 68 N/A INTRINSIC
Pfam:7tm_1 72 257 7e-21 PFAM
Pfam:7tm_1 243 311 8.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209442
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous targeted mutants have impaired C5 responses that can show increased or decreased acute inflammation under different circumstances, and thus affect severity of disease or infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,052,535 H5005Y unknown Het
Akap12 G T 10: 4,313,773 V61F possibly damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ap4e1 T A 2: 127,046,909 D459E probably damaging Het
Brdt C A 5: 107,350,188 P243Q probably benign Het
Cep104 T G 4: 153,994,508 V323G probably benign Het
Col11a1 A T 3: 114,216,995 probably benign Het
Fat3 T A 9: 15,925,091 Y4039F probably benign Het
Lmcd1 A C 6: 112,305,128 H41P probably damaging Het
Olfr466 T C 13: 65,152,383 L53P probably damaging Het
P2ry13 T C 3: 59,210,289 T23A probably benign Het
Pcdhb14 A T 18: 37,449,890 E683V probably benign Het
Pck1 G A 2: 173,158,410 E545K probably benign Het
Pkhd1l1 T C 15: 44,526,724 V1412A probably damaging Het
Rnf139 T C 15: 58,899,215 V363A probably damaging Het
Serpinh1 A G 7: 99,348,911 S171P probably damaging Het
Skint6 T C 4: 113,012,961 K600R possibly damaging Het
Slc7a1 C T 5: 148,345,936 E34K probably damaging Het
Spata31d1b AGGG AGG 13: 59,718,161 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Ttc6 A T 12: 57,616,369 N317I probably benign Het
Zan A T 5: 137,393,651 C4627* probably null Het
Zfhx4 T C 3: 5,396,961 V1232A possibly damaging Het
Other mutations in C5ar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0135:C5ar1 UTSW 7 16248939 missense probably damaging 1.00
R1527:C5ar1 UTSW 7 16248193 missense probably damaging 1.00
R4477:C5ar1 UTSW 7 16248864 missense probably damaging 1.00
R4812:C5ar1 UTSW 7 16248333 unclassified probably null
R5795:C5ar1 UTSW 7 16248394 missense possibly damaging 0.73
R5963:C5ar1 UTSW 7 16248822 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- GTGAAAGTCTTGCTATCCCTGCCC -3'
(R):5'- AGCTTCCCCAAAGAGAAGGCTGTG -3'

Sequencing Primer
(F):5'- TGAATCCTCAGAGAGAGCGTTTC -3'
(R):5'- GTTGCCTCTGCTCACTCTAA -3'
Posted On2014-02-11