Incidental Mutation 'R1338:Serpinh1'
ID156940
Institutional Source Beutler Lab
Gene Symbol Serpinh1
Ensembl Gene ENSMUSG00000070436
Gene Nameserine (or cysteine) peptidase inhibitor, clade H, member 1
SynonymsHsp47, gp46, Cbp2, Serpinh2, Cbp1, colligin, J6
MMRRC Submission 039403-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1338 (G1)
Quality Score112
Status Not validated
Chromosome7
Chromosomal Location99345376-99353239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99348911 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 171 (S171P)
Ref Sequence ENSEMBL: ENSMUSP00000146515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094154] [ENSMUST00000169437] [ENSMUST00000207849] [ENSMUST00000207989] [ENSMUST00000208119] [ENSMUST00000208292] [ENSMUST00000208749]
Predicted Effect probably damaging
Transcript: ENSMUST00000094154
AA Change: S171P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091706
Gene: ENSMUSG00000070436
AA Change: S171P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 51 408 6.88e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169437
AA Change: S171P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126390
Gene: ENSMUSG00000070436
AA Change: S171P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 51 408 6.88e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207849
AA Change: S171P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000207989
Predicted Effect probably damaging
Transcript: ENSMUST00000208119
AA Change: S171P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000208292
Predicted Effect probably damaging
Transcript: ENSMUST00000208749
AA Change: S171P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The encoded protein is localized to the endoplasmic reticulum and plays a role in collagen biosynthesis as a collagen-specific molecular chaperone. Autoantibodies to the encoded protein have been found in patients with rheumatoid arthritis. Expression of this gene may be a marker for cancer, and nucleotide polymorphisms in this gene may be associated with preterm birth caused by preterm premature rupture of membranes. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos before E11.5. Mice homozygous for a conditional allele activated in chondrocytes exhibit complete perinatal lethality, cleft palate, respiratory distress, abnormal chondocytes and bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,052,535 H5005Y unknown Het
Akap12 G T 10: 4,313,773 V61F possibly damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ap4e1 T A 2: 127,046,909 D459E probably damaging Het
Brdt C A 5: 107,350,188 P243Q probably benign Het
C5ar1 A C 7: 16,248,335 F253L probably damaging Het
Cep104 T G 4: 153,994,508 V323G probably benign Het
Col11a1 A T 3: 114,216,995 probably benign Het
Fat3 T A 9: 15,925,091 Y4039F probably benign Het
Lmcd1 A C 6: 112,305,128 H41P probably damaging Het
Olfr466 T C 13: 65,152,383 L53P probably damaging Het
P2ry13 T C 3: 59,210,289 T23A probably benign Het
Pcdhb14 A T 18: 37,449,890 E683V probably benign Het
Pck1 G A 2: 173,158,410 E545K probably benign Het
Pkhd1l1 T C 15: 44,526,724 V1412A probably damaging Het
Rnf139 T C 15: 58,899,215 V363A probably damaging Het
Skint6 T C 4: 113,012,961 K600R possibly damaging Het
Slc7a1 C T 5: 148,345,936 E34K probably damaging Het
Spata31d1b AGGG AGG 13: 59,718,161 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Ttc6 A T 12: 57,616,369 N317I probably benign Het
Zan A T 5: 137,393,651 C4627* probably null Het
Zfhx4 T C 3: 5,396,961 V1232A possibly damaging Het
Other mutations in Serpinh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02405:Serpinh1 APN 7 99347334 missense possibly damaging 0.94
IGL02506:Serpinh1 APN 7 99346992 missense probably damaging 1.00
R0070:Serpinh1 UTSW 7 99349314 missense probably damaging 1.00
R0070:Serpinh1 UTSW 7 99349314 missense probably damaging 1.00
R0608:Serpinh1 UTSW 7 99349394 missense unknown
R1612:Serpinh1 UTSW 7 99348931 missense probably damaging 0.97
R1916:Serpinh1 UTSW 7 99349081 missense probably damaging 1.00
R2321:Serpinh1 UTSW 7 99346385 missense probably damaging 1.00
R2886:Serpinh1 UTSW 7 99349021 missense probably damaging 1.00
R4176:Serpinh1 UTSW 7 99346999 missense probably benign
R5860:Serpinh1 UTSW 7 99346364 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCTTATCAGTAGCCCTGACTC -3'
(R):5'- AGAACATCCTCCTGTCACCCTTGG -3'

Sequencing Primer
(F):5'- TTTCCATAAGGAGAATCAAGCTCAGG -3'
(R):5'- GTCACTGGGTGGTAAAGCC -3'
Posted On2014-02-11