Incidental Mutation 'R1338:Rnf139'
ID156951
Institutional Source Beutler Lab
Gene Symbol Rnf139
Ensembl Gene ENSMUSG00000037075
Gene Namering finger protein 139
Synonyms4930555P18Rik
MMRRC Submission 039403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R1338 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location58889229-58907057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58899215 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 363 (V363A)
Ref Sequence ENSEMBL: ENSMUSP00000046467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036904] [ENSMUST00000110155] [ENSMUST00000226707] [ENSMUST00000227540] [ENSMUST00000228538] [ENSMUST00000228787]
Predicted Effect probably damaging
Transcript: ENSMUST00000036904
AA Change: V363A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046467
Gene: ENSMUSG00000037075
AA Change: V363A

DomainStartEndE-ValueType
Pfam:TRC8_N 19 516 5.1e-187 PFAM
RING 547 585 1.2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110155
SMART Domains Protein: ENSMUSP00000105783
Gene: ENSMUSG00000050891

DomainStartEndE-ValueType
Pfam:TatD_DNase 7 263 2.4e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226908
Predicted Effect probably benign
Transcript: ENSMUST00000227540
Predicted Effect probably benign
Transcript: ENSMUST00000228538
Predicted Effect probably benign
Transcript: ENSMUST00000228787
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a multi-membrane spanning protein containing a RING-H2 finger. This protein is located in the endoplasmic reticulum, and has been shown to possess ubiquitin ligase activity. This gene was found to be interrupted by a t(3:8) translocation in a family with hereditary renal and non-medulary thyroid cancer. Studies of the Drosophila counterpart suggested that this protein may interact with tumor suppressor protein VHL, as well as with COPS5/JAB1, a protein responsible for the degradation of tumor suppressor CDKN1B/P27KIP. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased diet-induced liver apoptosis, inflammation and fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,052,535 H5005Y unknown Het
Akap12 G T 10: 4,313,773 V61F possibly damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ap4e1 T A 2: 127,046,909 D459E probably damaging Het
Brdt C A 5: 107,350,188 P243Q probably benign Het
C5ar1 A C 7: 16,248,335 F253L probably damaging Het
Cep104 T G 4: 153,994,508 V323G probably benign Het
Col11a1 A T 3: 114,216,995 probably benign Het
Fat3 T A 9: 15,925,091 Y4039F probably benign Het
Lmcd1 A C 6: 112,305,128 H41P probably damaging Het
Olfr466 T C 13: 65,152,383 L53P probably damaging Het
P2ry13 T C 3: 59,210,289 T23A probably benign Het
Pcdhb14 A T 18: 37,449,890 E683V probably benign Het
Pck1 G A 2: 173,158,410 E545K probably benign Het
Pkhd1l1 T C 15: 44,526,724 V1412A probably damaging Het
Serpinh1 A G 7: 99,348,911 S171P probably damaging Het
Skint6 T C 4: 113,012,961 K600R possibly damaging Het
Slc7a1 C T 5: 148,345,936 E34K probably damaging Het
Spata31d1b AGGG AGG 13: 59,718,161 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Ttc6 A T 12: 57,616,369 N317I probably benign Het
Zan A T 5: 137,393,651 C4627* probably null Het
Zfhx4 T C 3: 5,396,961 V1232A possibly damaging Het
Other mutations in Rnf139
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Rnf139 APN 15 58898542 missense possibly damaging 0.75
IGL01288:Rnf139 APN 15 58899179 missense probably damaging 1.00
IGL01290:Rnf139 APN 15 58898326 missense probably benign
IGL02078:Rnf139 APN 15 58900031 missense possibly damaging 0.94
IGL02302:Rnf139 APN 15 58898757 missense probably damaging 0.99
IGL03029:Rnf139 APN 15 58899118 missense probably damaging 1.00
IGL03355:Rnf139 APN 15 58900032 missense probably benign 0.05
R0099:Rnf139 UTSW 15 58899415 missense probably damaging 1.00
R0158:Rnf139 UTSW 15 58898878 missense probably benign
R0331:Rnf139 UTSW 15 58899906 missense probably benign 0.01
R0334:Rnf139 UTSW 15 58899473 missense probably damaging 1.00
R0606:Rnf139 UTSW 15 58899827 missense probably damaging 1.00
R0680:Rnf139 UTSW 15 58899652 missense probably damaging 1.00
R1524:Rnf139 UTSW 15 58889417 missense probably damaging 0.99
R1528:Rnf139 UTSW 15 58899215 missense probably damaging 0.97
R1577:Rnf139 UTSW 15 58899518 missense probably damaging 1.00
R1870:Rnf139 UTSW 15 58899353 missense probably benign 0.00
R1889:Rnf139 UTSW 15 58899497 missense probably damaging 1.00
R4647:Rnf139 UTSW 15 58899987 missense probably benign 0.11
R4992:Rnf139 UTSW 15 58898476 nonsense probably null
R5088:Rnf139 UTSW 15 58899941 missense possibly damaging 0.74
R5246:Rnf139 UTSW 15 58899703 missense probably damaging 1.00
R5982:Rnf139 UTSW 15 58898838 missense possibly damaging 0.76
R5984:Rnf139 UTSW 15 58898746 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CAGACATACTTCGGGTCTTCTGGC -3'
(R):5'- GTTCCACACAAAAGGCTGTAACTGC -3'

Sequencing Primer
(F):5'- TTACAGCTCAGGCTACAGTG -3'
(R):5'- CTGCAAACAGCCATGTATTTAGTG -3'
Posted On2014-02-11