Incidental Mutation 'R1338:Pcdhb14'
ID156952
Institutional Source Beutler Lab
Gene Symbol Pcdhb14
Ensembl Gene ENSMUSG00000044043
Gene Nameprotocadherin beta 14
SynonymsPcdhbN, 2210006M07Rik, Pcdhb17
MMRRC Submission 039403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R1338 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37447656-37456350 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37449890 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 683 (E683V)
Ref Sequence ENSEMBL: ENSMUSP00000054111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052387] [ENSMUST00000056915] [ENSMUST00000115661] [ENSMUST00000194544]
PDB Structure
Solution structure of mouse protocadherin beta 14 (26-137) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000052387
AA Change: E683V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000054111
Gene: ENSMUSG00000044043
AA Change: E683V

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 1.4e-35 PFAM
CA 155 240 1.53e-20 SMART
CA 264 345 3.52e-29 SMART
CA 368 449 2.24e-22 SMART
CA 473 559 2.38e-26 SMART
CA 589 670 4.12e-12 SMART
Pfam:Cadherin_C_2 685 768 4.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056915
SMART Domains Protein: ENSMUSP00000061087
Gene: ENSMUSG00000047307

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 58 130 5.5e-1 SMART
CA 154 239 8.55e-19 SMART
CA 263 343 3.36e-26 SMART
CA 366 447 2.24e-22 SMART
CA 471 557 1.08e-24 SMART
CA 587 668 1.25e-11 SMART
Pfam:Cadherin_C_2 685 768 2.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 88.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,052,535 H5005Y unknown Het
Akap12 G T 10: 4,313,773 V61F possibly damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ap4e1 T A 2: 127,046,909 D459E probably damaging Het
Brdt C A 5: 107,350,188 P243Q probably benign Het
C5ar1 A C 7: 16,248,335 F253L probably damaging Het
Cep104 T G 4: 153,994,508 V323G probably benign Het
Col11a1 A T 3: 114,216,995 probably benign Het
Fat3 T A 9: 15,925,091 Y4039F probably benign Het
Lmcd1 A C 6: 112,305,128 H41P probably damaging Het
Olfr466 T C 13: 65,152,383 L53P probably damaging Het
P2ry13 T C 3: 59,210,289 T23A probably benign Het
Pck1 G A 2: 173,158,410 E545K probably benign Het
Pkhd1l1 T C 15: 44,526,724 V1412A probably damaging Het
Rnf139 T C 15: 58,899,215 V363A probably damaging Het
Serpinh1 A G 7: 99,348,911 S171P probably damaging Het
Skint6 T C 4: 113,012,961 K600R possibly damaging Het
Slc7a1 C T 5: 148,345,936 E34K probably damaging Het
Spata31d1b AGGG AGG 13: 59,718,161 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Ttc6 A T 12: 57,616,369 N317I probably benign Het
Zan A T 5: 137,393,651 C4627* probably null Het
Zfhx4 T C 3: 5,396,961 V1232A possibly damaging Het
Other mutations in Pcdhb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Pcdhb14 APN 18 37450033 missense probably benign 0.28
IGL02314:Pcdhb14 APN 18 37450195 missense probably benign 0.03
IGL02411:Pcdhb14 APN 18 37449770 missense possibly damaging 0.78
IGL02553:Pcdhb14 APN 18 37448018 nonsense probably null
IGL02797:Pcdhb14 APN 18 37449851 missense probably damaging 1.00
IGL03184:Pcdhb14 APN 18 37449032 missense probably benign 0.00
IGL03352:Pcdhb14 APN 18 37449004 missense possibly damaging 0.67
R0166:Pcdhb14 UTSW 18 37448489 unclassified probably null
R0467:Pcdhb14 UTSW 18 37449224 missense probably damaging 0.98
R0675:Pcdhb14 UTSW 18 37448339 missense possibly damaging 0.91
R0730:Pcdhb14 UTSW 18 37448868 missense probably damaging 1.00
R1119:Pcdhb14 UTSW 18 37448587 missense probably damaging 0.99
R1121:Pcdhb14 UTSW 18 37449592 missense probably damaging 1.00
R1726:Pcdhb14 UTSW 18 37449594 nonsense probably null
R1743:Pcdhb14 UTSW 18 37448178 missense probably benign 0.01
R1779:Pcdhb14 UTSW 18 37449482 missense probably damaging 1.00
R1795:Pcdhb14 UTSW 18 37449535 missense probably benign
R2131:Pcdhb14 UTSW 18 37447870 missense probably benign 0.00
R2133:Pcdhb14 UTSW 18 37447870 missense probably benign 0.00
R3792:Pcdhb14 UTSW 18 37449662 missense probably damaging 1.00
R3916:Pcdhb14 UTSW 18 37448545 missense possibly damaging 0.48
R4197:Pcdhb14 UTSW 18 37448305 missense probably benign 0.01
R4282:Pcdhb14 UTSW 18 37450142 missense probably damaging 1.00
R4657:Pcdhb14 UTSW 18 37448847 missense possibly damaging 0.92
R4801:Pcdhb14 UTSW 18 37448278 missense probably benign 0.28
R4802:Pcdhb14 UTSW 18 37448278 missense probably benign 0.28
R5022:Pcdhb14 UTSW 18 37450170 missense probably benign 0.03
R5034:Pcdhb14 UTSW 18 37448806 missense probably damaging 0.98
R5664:Pcdhb14 UTSW 18 37448996 missense possibly damaging 0.54
R5840:Pcdhb14 UTSW 18 37448750 missense probably benign 0.23
R5966:Pcdhb14 UTSW 18 37448242 missense probably benign
R6090:Pcdhb14 UTSW 18 37448606 missense probably benign 0.45
R6148:Pcdhb14 UTSW 18 37449230 missense probably damaging 1.00
R6187:Pcdhb14 UTSW 18 37448444 missense probably damaging 1.00
R6972:Pcdhb14 UTSW 18 37449692 missense probably damaging 1.00
X0065:Pcdhb14 UTSW 18 37449421 missense possibly damaging 0.95
X0065:Pcdhb14 UTSW 18 37449984 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCCAACTGCTCAAGACCACGG -3'
(R):5'- GCAGACCTCTTTCCACGAGTGAATG -3'

Sequencing Primer
(F):5'- TCAAGACCACGGAGCCTG -3'
(R):5'- ACTGGTAGCTCTGGGACAG -3'
Posted On2014-02-11