Incidental Mutation 'R1339:Inhbc'
ID 156963
Institutional Source Beutler Lab
Gene Symbol Inhbc
Ensembl Gene ENSMUSG00000025405
Gene Name inhibin beta-C
Synonyms activin beta-C
MMRRC Submission 039404-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1339 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 127192191-127206300 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 127193510 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 169 (V169L)
Ref Sequence ENSEMBL: ENSMUSP00000026472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026472] [ENSMUST00000059718]
AlphaFold P55104
Predicted Effect probably benign
Transcript: ENSMUST00000026472
AA Change: V169L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026472
Gene: ENSMUSG00000025405
AA Change: V169L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TGFB 247 352 7.32e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059718
SMART Domains Protein: ENSMUSP00000053977
Gene: ENSMUSG00000047492

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
TGFB 247 350 3.63e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219640
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate a subunit of homodimeric and heterodimeric activin complexes. The heterodimeric complex may function in the inhibition of activin A signaling. Transgenic mice overexpressing this gene exhibit defects in testis, liver and prostate. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null mutation display decreased serum albumin in females but are fertile with normal liver and reproductive morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,839,412 (GRCm39) probably null Het
Adamts20 A T 15: 94,220,777 (GRCm39) N1385K probably benign Het
Cplane2 A G 4: 140,945,859 (GRCm39) E134G probably damaging Het
Cyp4a32 A G 4: 115,468,760 (GRCm39) Y382C probably damaging Het
Dtnbp1 G A 13: 45,076,696 (GRCm39) S237L probably damaging Het
Foxi1 T C 11: 34,155,866 (GRCm39) T255A probably benign Het
Ifi208 A C 1: 173,510,804 (GRCm39) T320P probably damaging Het
Irf7 G A 7: 140,843,617 (GRCm39) R320C probably damaging Het
Marchf6 T C 15: 31,486,548 (GRCm39) T336A probably benign Het
Masp1 C A 16: 23,271,217 (GRCm39) C677F probably damaging Het
Mei1 A G 15: 81,966,196 (GRCm39) R323G possibly damaging Het
Or2a7 G C 6: 43,151,544 (GRCm39) G208A probably benign Het
Or6k8-ps1 G T 1: 173,979,777 (GRCm39) G232C probably damaging Het
Pira13 A G 7: 3,825,155 (GRCm39) Y496H probably damaging Het
Rel C T 11: 23,695,763 (GRCm39) C208Y probably damaging Het
Shc2 T G 10: 79,462,250 (GRCm39) T298P probably benign Het
Syne1 G A 10: 5,317,571 (GRCm39) L508F probably damaging Het
Ubn1 A G 16: 4,873,199 (GRCm39) K74E probably damaging Het
Other mutations in Inhbc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Inhbc APN 10 127,205,968 (GRCm39) missense probably damaging 1.00
IGL02114:Inhbc APN 10 127,205,971 (GRCm39) missense probably benign 0.00
LCD18:Inhbc UTSW 10 127,367,140 (GRCm38) intron probably benign
R0042:Inhbc UTSW 10 127,193,302 (GRCm39) missense probably benign 0.17
R0760:Inhbc UTSW 10 127,193,237 (GRCm39) missense probably damaging 1.00
R1754:Inhbc UTSW 10 127,206,162 (GRCm39) missense possibly damaging 0.84
R1867:Inhbc UTSW 10 127,193,416 (GRCm39) missense probably benign 0.01
R2902:Inhbc UTSW 10 127,193,621 (GRCm39) missense probably benign
R4622:Inhbc UTSW 10 127,193,146 (GRCm39) missense probably benign 0.26
R5128:Inhbc UTSW 10 127,193,611 (GRCm39) missense probably benign 0.12
R5285:Inhbc UTSW 10 127,193,269 (GRCm39) missense probably damaging 1.00
R5423:Inhbc UTSW 10 127,193,296 (GRCm39) missense probably damaging 1.00
R5807:Inhbc UTSW 10 127,193,411 (GRCm39) nonsense probably null
R5815:Inhbc UTSW 10 127,193,318 (GRCm39) missense probably benign 0.01
R6483:Inhbc UTSW 10 127,193,309 (GRCm39) nonsense probably null
R7423:Inhbc UTSW 10 127,193,275 (GRCm39) missense probably damaging 1.00
R8285:Inhbc UTSW 10 127,206,010 (GRCm39) missense probably benign
R8778:Inhbc UTSW 10 127,193,693 (GRCm39) missense probably damaging 1.00
R8859:Inhbc UTSW 10 127,192,984 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCATTCCAGCCAATCTCACGG -3'
(R):5'- ACACTCCAAAGGCTGCGATAACTTC -3'

Sequencing Primer
(F):5'- GGAAGTCTACGAAGAACTCTTGTC -3'
(R):5'- GCGATAACTTCCCTGTGGC -3'
Posted On 2014-02-11