Incidental Mutation 'R1339:4921517D22Rik'
ID156968
Institutional Source Beutler Lab
Gene Symbol 4921517D22Rik
Ensembl Gene ENSMUSG00000049902
Gene NameRIKEN cDNA 4921517D22 gene
Synonyms
MMRRC Submission 039404-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R1339 (G1)
Quality Score217
Status Not validated
Chromosome13
Chromosomal Location59687402-59694108 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCC to GC at 59691598 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153380 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000061597
Predicted Effect probably null
Transcript: ENSMUST00000225373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225788
Meta Mutation Damage Score 0.6464 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A T 15: 94,322,896 N1385K probably benign Het
Cyp4a32 A G 4: 115,611,563 Y382C probably damaging Het
Dtnbp1 G A 13: 44,923,220 S237L probably damaging Het
Foxi1 T C 11: 34,205,866 T255A probably benign Het
Gm15448 A G 7: 3,822,156 Y496H probably damaging Het
Ifi208 A C 1: 173,683,238 T320P probably damaging Het
Inhbc C A 10: 127,357,641 V169L probably benign Het
Irf7 G A 7: 141,263,704 R320C probably damaging Het
March6 T C 15: 31,486,402 T336A probably benign Het
Masp1 C A 16: 23,452,467 C677F probably damaging Het
Mei1 A G 15: 82,081,995 R323G possibly damaging Het
Olfr13 G C 6: 43,174,610 G208A probably benign Het
Olfr421-ps1 G T 1: 174,152,211 G232C probably damaging Het
Rel C T 11: 23,745,763 C208Y probably damaging Het
Rsg1 A G 4: 141,218,548 E134G probably damaging Het
Shc2 T G 10: 79,626,416 T298P probably benign Het
Syne1 G A 10: 5,367,571 L508F probably damaging Het
Ubn1 A G 16: 5,055,335 K74E probably damaging Het
Other mutations in 4921517D22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:4921517D22Rik APN 13 59689476 missense probably benign 0.00
IGL01516:4921517D22Rik APN 13 59690734 missense probably benign 0.00
R0395:4921517D22Rik UTSW 13 59689656 missense possibly damaging 0.94
R0579:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0664:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0757:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0758:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0777:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0779:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0814:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0870:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0872:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0873:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1062:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1064:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1149:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1149:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1151:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1152:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1207:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1207:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1285:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1358:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1359:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1360:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1361:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1679:4921517D22Rik UTSW 13 59691598 frame shift probably null
R4703:4921517D22Rik UTSW 13 59689528 missense possibly damaging 0.94
R4785:4921517D22Rik UTSW 13 59691592 missense probably benign
R4823:4921517D22Rik UTSW 13 59690904 missense probably damaging 0.99
R5054:4921517D22Rik UTSW 13 59689501 missense probably damaging 0.97
R6144:4921517D22Rik UTSW 13 59689533 missense probably damaging 0.99
R6977:4921517D22Rik UTSW 13 59691580 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGAAATGAAACTCCGGTGCCCC -3'
(R):5'- TCACCAATGAAATGGTCAGAGCTGC -3'

Sequencing Primer
(F):5'- CGCCTGCATGTGGTATCATA -3'
(R):5'- GCTACTTGAAACATGATTGACTCGAC -3'
Posted On2014-02-11