Mutagenetix > Incidental Mutations

Incidental Mutation 'R1339:4921517D22Rik'

156968

Institutional Source

Beutler Lab

Gene Symbol

4921517D22Rik

Ensembl Gene

ENSMUSG00000049902

Gene Name

RIKEN cDNA 4921517D22 gene

Synonyms

MMRRC Submission

039404-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R1339 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

59687402-59694108 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

GCC to GC at 59691598 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000153380 (fasta)

Predicted Effect

probably null
Transcript: ENSMUST00000061597

Predicted Effect

probably null
Transcript: ENSMUST00000225373

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225788

Meta Mutation Damage Score

0.6464

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts20	A	T	15: 94,322,896	N1385K	probably benign	Het
Cyp4a32	A	G	4: 115,611,563	Y382C	probably damaging	Het
Dtnbp1	G	A	13: 44,923,220	S237L	probably damaging	Het
Foxi1	T	C	11: 34,205,866	T255A	probably benign	Het
Gm15448	A	G	7: 3,822,156	Y496H	probably damaging	Het
Ifi208	A	C	1: 173,683,238	T320P	probably damaging	Het
Inhbc	C	A	10: 127,357,641	V169L	probably benign	Het
Irf7	G	A	7: 141,263,704	R320C	probably damaging	Het
March6	T	C	15: 31,486,402	T336A	probably benign	Het
Masp1	C	A	16: 23,452,467	C677F	probably damaging	Het
Mei1	A	G	15: 82,081,995	R323G	possibly damaging	Het
Olfr13	G	C	6: 43,174,610	G208A	probably benign	Het
Olfr421-ps1	G	T	1: 174,152,211	G232C	probably damaging	Het
Rel	C	T	11: 23,745,763	C208Y	probably damaging	Het
Rsg1	A	G	4: 141,218,548	E134G	probably damaging	Het
Shc2	T	G	10: 79,626,416	T298P	probably benign	Het
Syne1	G	A	10: 5,367,571	L508F	probably damaging	Het
Ubn1	A	G	16: 5,055,335	K74E	probably damaging	Het

Other mutations in 4921517D22Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00827:4921517D22Rik	APN	13	59689476	missense	probably benign	0.00
IGL01516:4921517D22Rik	APN	13	59690734	missense	probably benign	0.00
R0395:4921517D22Rik	UTSW	13	59689656	missense	possibly damaging	0.94
R0579:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R0664:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R0757:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R0758:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R0777:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R0779:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R0814:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R0870:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R0872:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R0873:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R1062:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R1064:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R1149:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R1149:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R1151:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R1152:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R1207:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R1207:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R1285:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R1358:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R1359:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R1360:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R1361:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R1679:4921517D22Rik	UTSW	13	59691598	frame shift	probably null
R4703:4921517D22Rik	UTSW	13	59689528	missense	possibly damaging	0.94
R4785:4921517D22Rik	UTSW	13	59691592	missense	probably benign
R4823:4921517D22Rik	UTSW	13	59690904	missense	probably damaging	0.99
R5054:4921517D22Rik	UTSW	13	59689501	missense	probably damaging	0.97
R6144:4921517D22Rik	UTSW	13	59689533	missense	probably damaging	0.99
R6977:4921517D22Rik	UTSW	13	59691580	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- TGAAATGAAACTCCGGTGCCCC -3'
(R):5'- TCACCAATGAAATGGTCAGAGCTGC -3'

Sequencing Primer
(F):5'- CGCCTGCATGTGGTATCATA -3'
(R):5'- GCTACTTGAAACATGATTGACTCGAC -3'

Posted On

2014-02-11