Incidental Mutation 'R1340:Alkbh2'
ID156988
Institutional Source Beutler Lab
Gene Symbol Alkbh2
Ensembl Gene ENSMUSG00000044339
Gene NamealkB homolog 2, alpha-ketoglutarate-dependent dioxygenase
SynonymsAbh2, mABH2
MMRRC Submission 039405-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1340 (G1)
Quality Score196
Status Validated
Chromosome5
Chromosomal Location114123926-114128218 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114124226 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 148 (E148K)
Ref Sequence ENSEMBL: ENSMUSP00000107898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031588] [ENSMUST00000053657] [ENSMUST00000112279] [ENSMUST00000149418] [ENSMUST00000200119]
Predicted Effect probably benign
Transcript: ENSMUST00000031588
SMART Domains Protein: ENSMUSP00000031588
Gene: ENSMUSG00000029592

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 499 2.6e-44 PFAM
Pfam:UCH_1 68 481 8.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053657
AA Change: E148K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056043
Gene: ENSMUSG00000044339
AA Change: E148K

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 1.9e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112279
AA Change: E148K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107898
Gene: ENSMUSG00000044339
AA Change: E148K

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 5.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149418
Predicted Effect probably benign
Transcript: ENSMUST00000200119
SMART Domains Protein: ENSMUSP00000142350
Gene: ENSMUSG00000029592

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 368 2.9e-31 PFAM
Pfam:UCH_1 68 376 1e-14 PFAM
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 and ALKBH3 (MIM 610603) are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are viable and overtly normal but show progressive accumulation of 1-methyladenine (1meA) in their genomic DNA due to impaired DNA repair. Mutant MEFs fail to remove methyl methane sulfate (MMS)-induced 1meA from genomic DNA and showincreased cytotoxicity after MMS exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,682,855 probably benign Het
Acat3 C T 17: 12,929,677 probably benign Het
Actn1 T C 12: 80,173,144 probably null Het
Adam8 G A 7: 139,991,377 S38F probably damaging Het
Aldh9a1 T G 1: 167,357,344 I275S probably benign Het
Alms1 G A 6: 85,667,957 probably null Het
Cacna1d A G 14: 30,072,067 V1539A probably damaging Het
Cacna1e A G 1: 154,472,657 L724P probably damaging Het
Ccdc110 A G 8: 45,942,181 T370A probably benign Het
Ccdc9 G A 7: 16,275,390 probably benign Het
Cep120 A T 18: 53,724,391 V334E probably damaging Het
Ces3a C T 8: 105,057,913 P462L probably damaging Het
Cgref1 A G 5: 30,945,346 probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csrnp3 T A 2: 66,002,396 F81Y probably damaging Het
Ddr2 T C 1: 169,998,084 T316A probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l5 A T 1: 119,549,131 *740R probably null Het
Gfpt2 A G 11: 49,832,861 K559E probably damaging Het
Gm2381 A G 7: 42,820,404 Y99H possibly damaging Het
Gsdma2 T C 11: 98,657,649 V242A probably damaging Het
Lrp1b T C 2: 40,702,794 N3771S probably benign Het
Lrriq4 A C 3: 30,650,323 T167P possibly damaging Het
Marc2 T C 1: 184,822,547 T254A probably benign Het
Naip2 G A 13: 100,189,122 L93F possibly damaging Het
Nefh G GNNNNNNNNNNNNNNNNNN 11: 4,941,002 probably benign Het
Nrp1 T C 8: 128,434,355 S321P probably damaging Het
Nt5c1b T C 12: 10,377,276 V342A probably damaging Het
Nt5c3 A G 6: 56,883,033 M273T probably benign Het
Olfr364-ps1 T G 2: 37,146,757 L182V probably benign Het
Olfr449 G A 6: 42,838,009 V43M probably benign Het
Olfr527 A G 7: 140,336,125 T88A probably benign Het
Polr3f A G 2: 144,538,628 H297R probably benign Het
Ptgs2 T G 1: 150,105,477 F504V probably damaging Het
Ptpro C T 6: 137,441,081 P142L possibly damaging Het
Rps17 A G 7: 81,343,733 probably null Het
Ryr1 A G 7: 29,116,012 S132P probably damaging Het
Sacs T C 14: 61,204,509 S1335P probably damaging Het
Senp6 T C 9: 80,122,023 V383A possibly damaging Het
Skint7 T C 4: 111,980,219 F65L probably damaging Het
Slc35f1 T C 10: 53,089,454 Y322H probably damaging Het
Slc38a4 C A 15: 97,010,272 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sox15 T A 11: 69,655,547 S59T probably damaging Het
Srcap T A 7: 127,560,738 probably benign Het
Txlnb A T 10: 17,842,740 I440F probably damaging Het
Uhrf1bp1 A G 17: 27,894,721 N1289S probably benign Het
Vmn1r178 A G 7: 23,893,856 S37G probably benign Het
Vmn2r75 T C 7: 86,148,590 T672A probably damaging Het
Wscd1 T C 11: 71,768,760 V222A probably benign Het
Other mutations in Alkbh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02298:Alkbh2 APN 5 114125572 missense probably benign
R0326:Alkbh2 UTSW 5 114123950 makesense probably null
R0480:Alkbh2 UTSW 5 114125535 missense probably damaging 1.00
R0962:Alkbh2 UTSW 5 114123953 missense possibly damaging 0.94
R1214:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1215:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1280:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1282:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1309:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1371:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1443:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1445:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1545:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1546:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1629:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1631:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1632:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1707:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1769:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1920:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1921:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1922:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1984:Alkbh2 UTSW 5 114124054 missense probably benign 0.12
R2140:Alkbh2 UTSW 5 114125716 missense probably benign 0.03
R2142:Alkbh2 UTSW 5 114125716 missense probably benign 0.03
R3800:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R3981:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4032:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4062:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4064:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4163:Alkbh2 UTSW 5 114127552 missense probably damaging 1.00
R4569:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4570:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4624:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4625:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4626:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4627:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4628:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4630:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4632:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4633:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4801:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4802:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4803:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCATCATCAGCAGGCTTCCGTG -3'
(R):5'- GACAGGCTTTCGGGCTGTGAAC -3'

Sequencing Primer
(F):5'- AGGCTTCCGTGTGCCAG -3'
(R):5'- acacagacagacagacagac -3'
Posted On2014-02-11