Incidental Mutation 'R1341:Hoxa13'
ID157040
Institutional Source Beutler Lab
Gene Symbol Hoxa13
Ensembl Gene ENSMUSG00000038203
Gene Namehomeobox A13
SynonymsHox-1.10
MMRRC Submission 039406-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1341 (G1)
Quality Score136
Status Not validated
Chromosome6
Chromosomal Location52257694-52260880 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CCG to CCGCG at 52260635 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047993] [ENSMUST00000114416] [ENSMUST00000147595]
Predicted Effect probably null
Transcript: ENSMUST00000047993
SMART Domains Protein: ENSMUSP00000039170
Gene: ENSMUSG00000038203

DomainStartEndE-ValueType
low complexity region 37 81 N/A INTRINSIC
Pfam:HoxA13_N 136 219 6.2e-25 PFAM
HOX 317 379 1.16e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114416
SMART Domains Protein: ENSMUSP00000110059
Gene: ENSMUSG00000038203

DomainStartEndE-ValueType
Pfam:HoxA13_N 1 55 1e-19 PFAM
HOX 153 215 1.16e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141300
Predicted Effect probably benign
Transcript: ENSMUST00000147595
SMART Domains Protein: ENSMUSP00000125221
Gene: ENSMUSG00000038203

DomainStartEndE-ValueType
Pfam:HoxA13_N 1 39 8.3e-11 PFAM
HOX 137 199 1.16e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192253
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.9%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Expansion of a polyalanine tract in the encoded protein can cause hand-foot-uterus syndrome, also known as hand-foot-genital syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit agenesis of both the urinary bladder and the caudal portion of the Mullerian ducts, premature stenosis of the umbilical arteries, loss of the most anterior digit of all feet, and death around mid-gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v0e2 A G 6: 48,540,111 Y75C probably benign Het
C87977 T C 4: 144,207,559 D326G probably damaging Het
Cacna1g A G 11: 94,433,756 L1190P probably damaging Het
Ccdc190 A G 1: 169,930,017 D15G probably damaging Het
Cep126 G T 9: 8,099,776 P919Q possibly damaging Het
Chchd6 A G 6: 89,384,641 V260A probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cramp1l T C 17: 24,977,540 K867E probably damaging Het
Dnah6 A T 6: 73,191,619 N440K probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm17421 A T 12: 113,369,714 noncoding transcript Het
Gm4788 T A 1: 139,732,393 T665S probably damaging Het
Hdac3 A G 18: 37,954,713 V36A probably damaging Het
Hist1h2bl T C 13: 21,716,110 K12E probably benign Het
Itga10 G A 3: 96,652,495 E489K probably damaging Het
Mgat5b A C 11: 116,978,397 I589L probably benign Het
Mindy4 A G 6: 55,255,616 N348S probably benign Het
Mmp15 A G 8: 95,372,303 D586G probably benign Het
Mmp9 A G 2: 164,949,327 D139G probably damaging Het
Morc2a C A 11: 3,680,216 L471I possibly damaging Het
Mycbp2 T A 14: 103,298,867 probably benign Het
Mylip T A 13: 45,405,936 S105T probably damaging Het
Nat8f4 A T 6: 85,901,424 L39Q probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Obscn T C 11: 59,029,372 probably benign Het
Olfr1086 T C 2: 86,677,163 M57V possibly damaging Het
Olfr1337 T C 4: 118,782,382 T68A probably benign Het
Olfr279 G A 15: 98,498,254 V261M possibly damaging Het
Olfr633 T A 7: 103,947,382 V272D possibly damaging Het
Olfr825 G T 10: 130,163,316 D3E probably benign Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Rab11fip1 G T 8: 27,143,360 A1106E probably damaging Het
Rfc1 A G 5: 65,291,194 S363P probably damaging Het
Skint10 A G 4: 112,765,031 probably benign Het
Spen T C 4: 141,469,400 N3595D possibly damaging Het
Swsap1 A G 9: 21,957,154 K241E probably benign Het
Tab1 A G 15: 80,160,114 T448A possibly damaging Het
Tktl1 G T X: 74,197,683 G302V probably damaging Het
Uhrf1bp1 T C 17: 27,877,419 probably benign Het
Usp25 A G 16: 77,115,443 T1017A probably benign Het
Vmn2r78 T A 7: 86,922,269 M429K possibly damaging Het
Wdr49 A T 3: 75,429,333 F356I probably damaging Het
Wnt1 T C 15: 98,791,883 F184L probably damaging Het
Yy1 T C 12: 108,793,519 I36T unknown Het
Zbtb39 A G 10: 127,743,500 I648V possibly damaging Het
Other mutations in Hoxa13
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8786:Hoxa13 UTSW 6 52260636 frame shift probably null
PIT4131001:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
PIT4131001:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
PIT4142001:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
PIT4142001:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R0458:Hoxa13 UTSW 6 52260635 frame shift probably null
R0496:Hoxa13 UTSW 6 52260635 frame shift probably null
R0502:Hoxa13 UTSW 6 52260635 frame shift probably null
R0512:Hoxa13 UTSW 6 52260635 frame shift probably null
R0784:Hoxa13 UTSW 6 52259937 missense probably damaging 0.98
R1062:Hoxa13 UTSW 6 52260635 frame shift probably null
R1157:Hoxa13 UTSW 6 52260635 frame shift probably null
R1192:Hoxa13 UTSW 6 52260635 frame shift probably null
R1310:Hoxa13 UTSW 6 52260635 frame shift probably null
R1343:Hoxa13 UTSW 6 52260635 frame shift probably null
R1398:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
R1398:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R1400:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
R1400:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R1450:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
R1450:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R1632:Hoxa13 UTSW 6 52259937 missense probably damaging 0.98
R2382:Hoxa13 UTSW 6 52259145 missense probably damaging 0.98
R3149:Hoxa13 UTSW 6 52260304 intron probably benign
R4012:Hoxa13 UTSW 6 52259127 missense possibly damaging 0.47
R4426:Hoxa13 UTSW 6 52260729 utr 5 prime probably benign
R5535:Hoxa13 UTSW 6 52260540 frame shift probably null
R6175:Hoxa13 UTSW 6 52259928 missense probably damaging 0.98
R7365:Hoxa13 UTSW 6 52259882 missense probably damaging 1.00
X0018:Hoxa13 UTSW 6 52260119 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGCGTAGCCCTGATGGTAGAAAGC -3'
(R):5'- TAAAACAGCGCCACTGGGGTCTTC -3'

Sequencing Primer
(F):5'- TGCCGAAGTAGCCGTAGG -3'
(R):5'- ACTGGGGTCTTCTCCATGC -3'
Posted On2014-02-11