Incidental Mutation 'R1341:Olfr825'
ID157053
Institutional Source Beutler Lab
Gene Symbol Olfr825
Ensembl Gene ENSMUSG00000058084
Gene Nameolfactory receptor 825
SynonymsGA_x6K02T2PULF-11834065-11833103, MOR210-1
MMRRC Submission 039406-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R1341 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location130159732-130166766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 130163316 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 3 (D3E)
Ref Sequence ENSEMBL: ENSMUSP00000149981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076814] [ENSMUST00000216530]
Predicted Effect probably benign
Transcript: ENSMUST00000076814
AA Change: D3E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000076091
Gene: ENSMUSG00000058084
AA Change: D3E

DomainStartEndE-ValueType
Pfam:7tm_4 34 309 8.8e-54 PFAM
Pfam:7TM_GPCR_Srsx 38 251 9.6e-6 PFAM
Pfam:7tm_1 44 291 2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216434
Predicted Effect probably benign
Transcript: ENSMUST00000216530
AA Change: D3E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218167
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.9%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v0e2 A G 6: 48,540,111 Y75C probably benign Het
C87977 T C 4: 144,207,559 D326G probably damaging Het
Cacna1g A G 11: 94,433,756 L1190P probably damaging Het
Ccdc190 A G 1: 169,930,017 D15G probably damaging Het
Cep126 G T 9: 8,099,776 P919Q possibly damaging Het
Chchd6 A G 6: 89,384,641 V260A probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cramp1l T C 17: 24,977,540 K867E probably damaging Het
Dnah6 A T 6: 73,191,619 N440K probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm17421 A T 12: 113,369,714 noncoding transcript Het
Gm4788 T A 1: 139,732,393 T665S probably damaging Het
Hdac3 A G 18: 37,954,713 V36A probably damaging Het
Hist1h2bl T C 13: 21,716,110 K12E probably benign Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Itga10 G A 3: 96,652,495 E489K probably damaging Het
Mgat5b A C 11: 116,978,397 I589L probably benign Het
Mindy4 A G 6: 55,255,616 N348S probably benign Het
Mmp15 A G 8: 95,372,303 D586G probably benign Het
Mmp9 A G 2: 164,949,327 D139G probably damaging Het
Morc2a C A 11: 3,680,216 L471I possibly damaging Het
Mycbp2 T A 14: 103,298,867 probably benign Het
Mylip T A 13: 45,405,936 S105T probably damaging Het
Nat8f4 A T 6: 85,901,424 L39Q probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Obscn T C 11: 59,029,372 probably benign Het
Olfr1086 T C 2: 86,677,163 M57V possibly damaging Het
Olfr1337 T C 4: 118,782,382 T68A probably benign Het
Olfr279 G A 15: 98,498,254 V261M possibly damaging Het
Olfr633 T A 7: 103,947,382 V272D possibly damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Rab11fip1 G T 8: 27,143,360 A1106E probably damaging Het
Rfc1 A G 5: 65,291,194 S363P probably damaging Het
Skint10 A G 4: 112,765,031 probably benign Het
Spen T C 4: 141,469,400 N3595D possibly damaging Het
Swsap1 A G 9: 21,957,154 K241E probably benign Het
Tab1 A G 15: 80,160,114 T448A possibly damaging Het
Tktl1 G T X: 74,197,683 G302V probably damaging Het
Uhrf1bp1 T C 17: 27,877,419 probably benign Het
Usp25 A G 16: 77,115,443 T1017A probably benign Het
Vmn2r78 T A 7: 86,922,269 M429K possibly damaging Het
Wdr49 A T 3: 75,429,333 F356I probably damaging Het
Wnt1 T C 15: 98,791,883 F184L probably damaging Het
Yy1 T C 12: 108,793,519 I36T unknown Het
Zbtb39 A G 10: 127,743,500 I648V possibly damaging Het
Other mutations in Olfr825
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03244:Olfr825 APN 10 130162400 nonsense probably null
R1120:Olfr825 UTSW 10 130162537 missense probably damaging 1.00
R1754:Olfr825 UTSW 10 130163164 missense probably benign 0.02
R2022:Olfr825 UTSW 10 130163180 missense probably benign 0.00
R2027:Olfr825 UTSW 10 130162735 missense probably benign 0.00
R3838:Olfr825 UTSW 10 130162406 nonsense probably null
R3842:Olfr825 UTSW 10 130162901 missense probably benign 0.00
R4737:Olfr825 UTSW 10 130162838 missense probably benign 0.01
R5166:Olfr825 UTSW 10 130162561 missense possibly damaging 0.60
R5744:Olfr825 UTSW 10 130162792 missense possibly damaging 0.92
R5899:Olfr825 UTSW 10 130162673 missense probably benign 0.00
X0026:Olfr825 UTSW 10 130162731 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCACACAGCCTGCAAATGAGATAG -3'
(R):5'- GCACACCTCCTAGATCATGTTCCAC -3'

Sequencing Primer
(F):5'- GCTCATAGCCTTTGGTGCAATAAC -3'
(R):5'- TTGAGGCCCACGGTCATAG -3'
Posted On2014-02-11