Incidental Mutation 'R1353:Gm13757'
ID157075
Institutional Source Beutler Lab
Gene Symbol Gm13757
Ensembl Gene ENSMUSG00000090097
Gene Namepredicted gene 13757
Synonyms
MMRRC Submission 039418-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock #R1353 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88442814-88449131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88446551 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 129 (H129R)
Ref Sequence ENSEMBL: ENSMUSP00000136580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102619] [ENSMUST00000126038] [ENSMUST00000179450]
Predicted Effect probably benign
Transcript: ENSMUST00000102619
AA Change: H129R

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099679
Gene: ENSMUSG00000075125
AA Change: H129R

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
Pfam:7tm_1 39 285 7.2e-26 PFAM
Pfam:7tm_4 137 278 3.5e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126038
AA Change: H129R

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000179450
AA Change: H129R

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136580
Gene: ENSMUSG00000090097
AA Change: H129R

DomainStartEndE-ValueType
Pfam:7tm_4 26 303 1.4e-49 PFAM
Pfam:7tm_1 39 285 1.5e-13 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.1%
  • 20x: 86.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Astn2 T C 4: 66,266,335 Q175R unknown Het
Capn9 A C 8: 124,605,566 probably null Het
Car9 G T 4: 43,512,439 probably null Het
Chd7 A G 4: 8,839,556 N1364S probably damaging Het
Cmya5 A T 13: 93,041,525 V3607E probably damaging Het
Crb2 T C 2: 37,787,281 C262R probably damaging Het
Cyp2t4 A G 7: 27,156,630 N204S probably benign Het
Epha1 T C 6: 42,361,837 T676A probably damaging Het
Fancm G A 12: 65,088,170 V246M probably damaging Het
Fcrl5 T C 3: 87,448,362 S461P probably damaging Het
Gen1 A T 12: 11,243,219 L394Q probably benign Het
Hsdl2 G T 4: 59,596,971 probably null Het
Klri2 C T 6: 129,739,086 G97S probably damaging Het
Lypla2 T C 4: 135,970,467 I55V probably null Het
Malrd1 A G 2: 16,127,968 D1900G unknown Het
Map1b A G 13: 99,427,326 S2378P unknown Het
March3 A T 18: 56,776,105 probably null Het
Myom2 G T 8: 15,106,424 W757L probably damaging Het
Nat10 T A 2: 103,754,073 M120L possibly damaging Het
Ncam2 T G 16: 81,200,915 M1R probably null Het
Ncoa4 G T 14: 32,170,858 G33* probably null Het
Olfr3 C A 2: 36,812,914 M59I possibly damaging Het
Olfr434 T A 6: 43,217,690 M259K probably benign Het
Olfr54 G A 11: 51,027,006 M1I probably null Het
Olfr768 C T 10: 129,093,864 V37I probably benign Het
Olfr890 A C 9: 38,143,728 I198L probably benign Het
Osbpl8 A G 10: 111,276,479 N485S probably damaging Het
Pkdrej A T 15: 85,818,918 V939E probably damaging Het
Plaa T C 4: 94,571,689 E607G possibly damaging Het
Rtel1 T A 2: 181,349,231 C285S probably benign Het
Rtl1 A C 12: 109,592,199 C1069G probably benign Het
Rtn4 C A 11: 29,707,595 A583E probably damaging Het
Runx1 T A 16: 92,689,051 R32* probably null Het
Sdcbp A G 4: 6,381,057 I67M probably damaging Het
Slc22a12 G C 19: 6,537,782 L259V possibly damaging Het
Sptlc2 A G 12: 87,341,746 S321P probably damaging Het
Tmem30c C T 16: 57,277,665 G131D probably damaging Het
Tnfaip2 A T 12: 111,444,969 Q9L probably damaging Het
Ttn T C 2: 76,746,566 Y24661C probably damaging Het
Vmn2r77 T G 7: 86,802,186 F427V probably benign Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zfp354b A T 11: 50,923,413 H228Q probably damaging Het
Zfp84 T A 7: 29,776,175 N97K probably benign Het
Zfp976 T C 7: 42,616,018 D49G probably damaging Het
Zgrf1 C T 3: 127,611,803 T1550I probably damaging Het
Other mutations in Gm13757
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0241:Gm13757 UTSW 2 88446545 missense possibly damaging 0.48
R0627:Gm13757 UTSW 2 88446219 missense probably damaging 1.00
R0634:Gm13757 UTSW 2 88446617 missense probably benign 0.10
R1305:Gm13757 UTSW 2 88446302 nonsense probably null
R1765:Gm13757 UTSW 2 88446023 missense probably damaging 1.00
R1974:Gm13757 UTSW 2 88446509 missense probably damaging 0.97
R1990:Gm13757 UTSW 2 88446689 missense probably damaging 1.00
R2196:Gm13757 UTSW 2 88446710 missense probably benign 0.10
R2974:Gm13757 UTSW 2 88446574 nonsense probably null
R4794:Gm13757 UTSW 2 88446347 missense probably benign 0.12
R5495:Gm13757 UTSW 2 88446057 missense probably benign 0.03
R5771:Gm13757 UTSW 2 88446308 missense possibly damaging 0.94
R6654:Gm13757 UTSW 2 88446672 missense possibly damaging 0.80
R6756:Gm13757 UTSW 2 88446734 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GGCAACCATTCCTGAATTGGCAAC -3'
(R):5'- ACCTCCTGTGTGACACCCAAATTG -3'

Sequencing Primer
(F):5'- TCCTGAATTGGCAACCATGAG -3'
(R):5'- CACCCAAATTGATTGGGGATCTG -3'
Posted On2014-02-11