Incidental Mutation 'R1353:Car9'
ID157084
Institutional Source Beutler Lab
Gene Symbol Car9
Ensembl Gene ENSMUSG00000028463
Gene Namecarbonic anhydrase 9
SynonymsCAIX, MN/CA9
MMRRC Submission 039418-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1353 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43506966-43513729 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 43512439 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030183] [ENSMUST00000030184] [ENSMUST00000107913] [ENSMUST00000107914]
Predicted Effect probably null
Transcript: ENSMUST00000030183
SMART Domains Protein: ENSMUSP00000030183
Gene: ENSMUSG00000028463

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 61 80 N/A INTRINSIC
Carb_anhydrase 120 369 2.72e-103 SMART
Blast:Carb_anhydrase 378 427 7e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000030184
SMART Domains Protein: ENSMUSP00000030184
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 3.3e-39 PFAM
Pfam:Tropomyosin 48 284 1.5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107913
SMART Domains Protein: ENSMUSP00000103546
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 6.5e-36 PFAM
Pfam:Tropomyosin 48 284 4.8e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107914
SMART Domains Protein: ENSMUSP00000103547
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 7.2e-39 PFAM
Pfam:Tropomyosin 48 284 6.3e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133355
Predicted Effect probably null
Transcript: ENSMUST00000138073
SMART Domains Protein: ENSMUSP00000114493
Gene: ENSMUSG00000028463

DomainStartEndE-ValueType
Carb_anhydrase 35 237 6.18e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154251
Meta Mutation Damage Score 0.632 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.1%
  • 20x: 86.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA IX is a transmembrane protein and is one of only two tumor-associated carbonic anhydrase isoenzymes known. It is expressed in all clear-cell renal cell carcinoma, but is not detected in normal kidney or most other normal tissues. It may be involved in cell proliferation and transformation. This gene was mapped to 17q21.2 by fluorescence in situ hybridization, however, radiation hybrid mapping localized it to 9p13-p12. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile but develop hyperplasia of the glandular gastric epithelium with numerous cysts. Mice homozygous for a different mutation show an increased mean percentage of mature B cells in bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Astn2 T C 4: 66,266,335 Q175R unknown Het
Capn9 A C 8: 124,605,566 probably null Het
Chd7 A G 4: 8,839,556 N1364S probably damaging Het
Cmya5 A T 13: 93,041,525 V3607E probably damaging Het
Crb2 T C 2: 37,787,281 C262R probably damaging Het
Cyp2t4 A G 7: 27,156,630 N204S probably benign Het
Epha1 T C 6: 42,361,837 T676A probably damaging Het
Fancm G A 12: 65,088,170 V246M probably damaging Het
Fcrl5 T C 3: 87,448,362 S461P probably damaging Het
Gen1 A T 12: 11,243,219 L394Q probably benign Het
Gm13757 T C 2: 88,446,551 H129R probably benign Het
Hsdl2 G T 4: 59,596,971 probably null Het
Klri2 C T 6: 129,739,086 G97S probably damaging Het
Lypla2 T C 4: 135,970,467 I55V probably null Het
Malrd1 A G 2: 16,127,968 D1900G unknown Het
Map1b A G 13: 99,427,326 S2378P unknown Het
March3 A T 18: 56,776,105 probably null Het
Myom2 G T 8: 15,106,424 W757L probably damaging Het
Nat10 T A 2: 103,754,073 M120L possibly damaging Het
Ncam2 T G 16: 81,200,915 M1R probably null Het
Ncoa4 G T 14: 32,170,858 G33* probably null Het
Olfr3 C A 2: 36,812,914 M59I possibly damaging Het
Olfr434 T A 6: 43,217,690 M259K probably benign Het
Olfr54 G A 11: 51,027,006 M1I probably null Het
Olfr768 C T 10: 129,093,864 V37I probably benign Het
Olfr890 A C 9: 38,143,728 I198L probably benign Het
Osbpl8 A G 10: 111,276,479 N485S probably damaging Het
Pkdrej A T 15: 85,818,918 V939E probably damaging Het
Plaa T C 4: 94,571,689 E607G possibly damaging Het
Rtel1 T A 2: 181,349,231 C285S probably benign Het
Rtl1 A C 12: 109,592,199 C1069G probably benign Het
Rtn4 C A 11: 29,707,595 A583E probably damaging Het
Runx1 T A 16: 92,689,051 R32* probably null Het
Sdcbp A G 4: 6,381,057 I67M probably damaging Het
Slc22a12 G C 19: 6,537,782 L259V possibly damaging Het
Sptlc2 A G 12: 87,341,746 S321P probably damaging Het
Tmem30c C T 16: 57,277,665 G131D probably damaging Het
Tnfaip2 A T 12: 111,444,969 Q9L probably damaging Het
Ttn T C 2: 76,746,566 Y24661C probably damaging Het
Vmn2r77 T G 7: 86,802,186 F427V probably benign Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zfp354b A T 11: 50,923,413 H228Q probably damaging Het
Zfp84 T A 7: 29,776,175 N97K probably benign Het
Zfp976 T C 7: 42,616,018 D49G probably damaging Het
Zgrf1 C T 3: 127,611,803 T1550I probably damaging Het
Other mutations in Car9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Car9 APN 4 43512941 splice site probably benign
IGL01893:Car9 APN 4 43510252 missense probably damaging 1.00
IGL02064:Car9 APN 4 43507363 missense probably benign
R0122:Car9 UTSW 4 43512206 missense probably benign 0.05
R0314:Car9 UTSW 4 43509212 critical splice donor site probably null
R0497:Car9 UTSW 4 43511881 missense probably damaging 1.00
R1018:Car9 UTSW 4 43512439 critical splice donor site probably null
R1132:Car9 UTSW 4 43512439 critical splice donor site probably null
R1218:Car9 UTSW 4 43512439 critical splice donor site probably null
R1219:Car9 UTSW 4 43512439 critical splice donor site probably null
R1222:Car9 UTSW 4 43512439 critical splice donor site probably null
R1350:Car9 UTSW 4 43512439 critical splice donor site probably null
R1351:Car9 UTSW 4 43512439 critical splice donor site probably null
R1352:Car9 UTSW 4 43512439 critical splice donor site probably null
R1389:Car9 UTSW 4 43512439 critical splice donor site probably null
R1417:Car9 UTSW 4 43512439 critical splice donor site probably null
R1470:Car9 UTSW 4 43510222 missense probably damaging 1.00
R1470:Car9 UTSW 4 43510222 missense probably damaging 1.00
R1573:Car9 UTSW 4 43512439 critical splice donor site probably null
R1818:Car9 UTSW 4 43512439 critical splice donor site probably null
R1819:Car9 UTSW 4 43512439 critical splice donor site probably null
R4033:Car9 UTSW 4 43508624 missense possibly damaging 0.52
R4597:Car9 UTSW 4 43509138 missense probably damaging 1.00
R4609:Car9 UTSW 4 43507267 missense possibly damaging 0.81
R4719:Car9 UTSW 4 43508616 nonsense probably null
R5402:Car9 UTSW 4 43510213 missense probably damaging 1.00
R5624:Car9 UTSW 4 43509146 missense probably benign 0.03
R6471:Car9 UTSW 4 43511938 missense probably damaging 1.00
R6850:Car9 UTSW 4 43507321 missense probably damaging 0.96
X0067:Car9 UTSW 4 43507198 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCGTGATTCTCGGCTACAACTGAAC -3'
(R):5'- CTTCCAGCAGCTAGGTGAAAGGTG -3'

Sequencing Primer
(F):5'- ACCCTTGAATGGGCGAAC -3'
(R):5'- AGATTTCTGGAGCCTCATTCAGAC -3'
Posted On2014-02-11