Incidental Mutation 'R1353:Hsdl2'
ID157085
Institutional Source Beutler Lab
Gene Symbol Hsdl2
Ensembl Gene ENSMUSG00000028383
Gene Namehydroxysteroid dehydrogenase like 2
Synonyms2610207I16Rik
MMRRC Submission 039418-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R1353 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location59581563-59618689 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to T at 59596971 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030078] [ENSMUST00000107528] [ENSMUST00000128792]
Predicted Effect probably null
Transcript: ENSMUST00000030078
SMART Domains Protein: ENSMUSP00000030078
Gene: ENSMUSG00000028383

DomainStartEndE-ValueType
Pfam:KR 11 142 6.3e-7 PFAM
Pfam:adh_short 11 209 2.9e-37 PFAM
Pfam:adh_short_C2 17 217 3.3e-11 PFAM
low complexity region 295 367 N/A INTRINSIC
Pfam:SCP2 382 484 4.1e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107528
SMART Domains Protein: ENSMUSP00000103152
Gene: ENSMUSG00000028383

DomainStartEndE-ValueType
PDB:3KVO|B 1 174 1e-98 PDB
low complexity region 175 247 N/A INTRINSIC
Pfam:SCP2 262 364 2.5e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000128792
SMART Domains Protein: ENSMUSP00000119139
Gene: ENSMUSG00000028383

DomainStartEndE-ValueType
SCOP:d1hu4a_ 9 122 1e-19 SMART
PDB:3KVO|B 9 149 8e-83 PDB
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.1%
  • 20x: 86.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Astn2 T C 4: 66,266,335 Q175R unknown Het
Capn9 A C 8: 124,605,566 probably null Het
Car9 G T 4: 43,512,439 probably null Het
Chd7 A G 4: 8,839,556 N1364S probably damaging Het
Cmya5 A T 13: 93,041,525 V3607E probably damaging Het
Crb2 T C 2: 37,787,281 C262R probably damaging Het
Cyp2t4 A G 7: 27,156,630 N204S probably benign Het
Epha1 T C 6: 42,361,837 T676A probably damaging Het
Fancm G A 12: 65,088,170 V246M probably damaging Het
Fcrl5 T C 3: 87,448,362 S461P probably damaging Het
Gen1 A T 12: 11,243,219 L394Q probably benign Het
Gm13757 T C 2: 88,446,551 H129R probably benign Het
Klri2 C T 6: 129,739,086 G97S probably damaging Het
Lypla2 T C 4: 135,970,467 I55V probably null Het
Malrd1 A G 2: 16,127,968 D1900G unknown Het
Map1b A G 13: 99,427,326 S2378P unknown Het
March3 A T 18: 56,776,105 probably null Het
Myom2 G T 8: 15,106,424 W757L probably damaging Het
Nat10 T A 2: 103,754,073 M120L possibly damaging Het
Ncam2 T G 16: 81,200,915 M1R probably null Het
Ncoa4 G T 14: 32,170,858 G33* probably null Het
Olfr3 C A 2: 36,812,914 M59I possibly damaging Het
Olfr434 T A 6: 43,217,690 M259K probably benign Het
Olfr54 G A 11: 51,027,006 M1I probably null Het
Olfr768 C T 10: 129,093,864 V37I probably benign Het
Olfr890 A C 9: 38,143,728 I198L probably benign Het
Osbpl8 A G 10: 111,276,479 N485S probably damaging Het
Pkdrej A T 15: 85,818,918 V939E probably damaging Het
Plaa T C 4: 94,571,689 E607G possibly damaging Het
Rtel1 T A 2: 181,349,231 C285S probably benign Het
Rtl1 A C 12: 109,592,199 C1069G probably benign Het
Rtn4 C A 11: 29,707,595 A583E probably damaging Het
Runx1 T A 16: 92,689,051 R32* probably null Het
Sdcbp A G 4: 6,381,057 I67M probably damaging Het
Slc22a12 G C 19: 6,537,782 L259V possibly damaging Het
Sptlc2 A G 12: 87,341,746 S321P probably damaging Het
Tmem30c C T 16: 57,277,665 G131D probably damaging Het
Tnfaip2 A T 12: 111,444,969 Q9L probably damaging Het
Ttn T C 2: 76,746,566 Y24661C probably damaging Het
Vmn2r77 T G 7: 86,802,186 F427V probably benign Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zfp354b A T 11: 50,923,413 H228Q probably damaging Het
Zfp84 T A 7: 29,776,175 N97K probably benign Het
Zfp976 T C 7: 42,616,018 D49G probably damaging Het
Zgrf1 C T 3: 127,611,803 T1550I probably damaging Het
Other mutations in Hsdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Hsdl2 APN 4 59596892 missense probably benign 0.26
IGL00857:Hsdl2 APN 4 59617735 missense probably benign 0.29
IGL01859:Hsdl2 APN 4 59601569 critical splice donor site probably null
IGL02822:Hsdl2 APN 4 59601379 missense possibly damaging 0.55
IGL03028:Hsdl2 APN 4 59594471 missense probably damaging 0.98
IGL03275:Hsdl2 APN 4 59617747 makesense probably null
R0217:Hsdl2 UTSW 4 59597311 missense probably damaging 1.00
R0294:Hsdl2 UTSW 4 59601408 missense probably benign 0.00
R0448:Hsdl2 UTSW 4 59606523 missense unknown
R0490:Hsdl2 UTSW 4 59612814 splice site probably benign
R1668:Hsdl2 UTSW 4 59612697 missense probably damaging 1.00
R3933:Hsdl2 UTSW 4 59597274 missense probably damaging 1.00
R4088:Hsdl2 UTSW 4 59610636 missense unknown
R4247:Hsdl2 UTSW 4 59594417 missense probably damaging 1.00
R4449:Hsdl2 UTSW 4 59617692 missense possibly damaging 0.61
R4723:Hsdl2 UTSW 4 59593270 unclassified probably benign
R4858:Hsdl2 UTSW 4 59612812 critical splice donor site probably null
R5361:Hsdl2 UTSW 4 59592301 unclassified probably benign
R6435:Hsdl2 UTSW 4 59610668 missense unknown
R6525:Hsdl2 UTSW 4 59612696 missense probably damaging 0.99
R6536:Hsdl2 UTSW 4 59610508 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCAGCACATCACTGAGCAAG -3'
(R):5'- GTGACCTGAGACACTGCACAAGAG -3'

Sequencing Primer
(F):5'- GCACATCACTGAGCAAGTTTAGTTAC -3'
(R):5'- tcacattacatcctgcccac -3'
Posted On2014-02-11