Incidental Mutation 'R1353:Zfp84'
ID157094
Institutional Source Beutler Lab
Gene Symbol Zfp84
Ensembl Gene ENSMUSG00000046185
Gene Namezinc finger protein 84
SynonymsC86188, 4633401C23Rik, Zfp69, KRAB18, 2210410P13Rik
MMRRC Submission 039418-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1353 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29768552-29779821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29776175 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 97 (N97K)
Ref Sequence ENSEMBL: ENSMUSP00000032802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032802]
Predicted Effect probably benign
Transcript: ENSMUST00000032802
AA Change: N97K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000032802
Gene: ENSMUSG00000046185
AA Change: N97K

DomainStartEndE-ValueType
KRAB 14 74 9.09e-36 SMART
ZnF_C2H2 249 271 1.67e-2 SMART
ZnF_C2H2 277 299 1.43e-1 SMART
ZnF_C2H2 305 327 5.81e-2 SMART
ZnF_C2H2 333 355 1.95e-3 SMART
ZnF_C2H2 361 383 8.6e-5 SMART
ZnF_C2H2 389 411 2.32e-1 SMART
ZnF_C2H2 417 439 3.89e-3 SMART
ZnF_C2H2 445 467 1.69e-3 SMART
ZnF_C2H2 473 495 9.58e-3 SMART
ZnF_C2H2 501 523 1.38e-3 SMART
ZnF_C2H2 529 551 1.58e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158514
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.1%
  • 20x: 86.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Astn2 T C 4: 66,266,335 Q175R unknown Het
Capn9 A C 8: 124,605,566 probably null Het
Car9 G T 4: 43,512,439 probably null Het
Chd7 A G 4: 8,839,556 N1364S probably damaging Het
Cmya5 A T 13: 93,041,525 V3607E probably damaging Het
Crb2 T C 2: 37,787,281 C262R probably damaging Het
Cyp2t4 A G 7: 27,156,630 N204S probably benign Het
Epha1 T C 6: 42,361,837 T676A probably damaging Het
Fancm G A 12: 65,088,170 V246M probably damaging Het
Fcrl5 T C 3: 87,448,362 S461P probably damaging Het
Gen1 A T 12: 11,243,219 L394Q probably benign Het
Gm13757 T C 2: 88,446,551 H129R probably benign Het
Hsdl2 G T 4: 59,596,971 probably null Het
Klri2 C T 6: 129,739,086 G97S probably damaging Het
Lypla2 T C 4: 135,970,467 I55V probably null Het
Malrd1 A G 2: 16,127,968 D1900G unknown Het
Map1b A G 13: 99,427,326 S2378P unknown Het
March3 A T 18: 56,776,105 probably null Het
Myom2 G T 8: 15,106,424 W757L probably damaging Het
Nat10 T A 2: 103,754,073 M120L possibly damaging Het
Ncam2 T G 16: 81,200,915 M1R probably null Het
Ncoa4 G T 14: 32,170,858 G33* probably null Het
Olfr3 C A 2: 36,812,914 M59I possibly damaging Het
Olfr434 T A 6: 43,217,690 M259K probably benign Het
Olfr54 G A 11: 51,027,006 M1I probably null Het
Olfr768 C T 10: 129,093,864 V37I probably benign Het
Olfr890 A C 9: 38,143,728 I198L probably benign Het
Osbpl8 A G 10: 111,276,479 N485S probably damaging Het
Pkdrej A T 15: 85,818,918 V939E probably damaging Het
Plaa T C 4: 94,571,689 E607G possibly damaging Het
Rtel1 T A 2: 181,349,231 C285S probably benign Het
Rtl1 A C 12: 109,592,199 C1069G probably benign Het
Rtn4 C A 11: 29,707,595 A583E probably damaging Het
Runx1 T A 16: 92,689,051 R32* probably null Het
Sdcbp A G 4: 6,381,057 I67M probably damaging Het
Slc22a12 G C 19: 6,537,782 L259V possibly damaging Het
Sptlc2 A G 12: 87,341,746 S321P probably damaging Het
Tmem30c C T 16: 57,277,665 G131D probably damaging Het
Tnfaip2 A T 12: 111,444,969 Q9L probably damaging Het
Ttn T C 2: 76,746,566 Y24661C probably damaging Het
Vmn2r77 T G 7: 86,802,186 F427V probably benign Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zfp354b A T 11: 50,923,413 H228Q probably damaging Het
Zfp976 T C 7: 42,616,018 D49G probably damaging Het
Zgrf1 C T 3: 127,611,803 T1550I probably damaging Het
Other mutations in Zfp84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01768:Zfp84 APN 7 29776666 missense probably benign 0.16
IGL03022:Zfp84 APN 7 29775334 splice site probably benign
R0666:Zfp84 UTSW 7 29776851 missense probably damaging 1.00
R0781:Zfp84 UTSW 7 29771372 start codon destroyed probably null 0.02
R1110:Zfp84 UTSW 7 29771372 start codon destroyed probably null 0.02
R1495:Zfp84 UTSW 7 29777303 nonsense probably null
R1496:Zfp84 UTSW 7 29776614 missense possibly damaging 0.53
R1681:Zfp84 UTSW 7 29777400 missense probably damaging 1.00
R1827:Zfp84 UTSW 7 29777343 missense possibly damaging 0.91
R1854:Zfp84 UTSW 7 29775371 missense possibly damaging 0.84
R2209:Zfp84 UTSW 7 29777182 missense probably damaging 0.99
R2843:Zfp84 UTSW 7 29775333 splice site probably null
R2844:Zfp84 UTSW 7 29775333 splice site probably null
R4691:Zfp84 UTSW 7 29777080 missense probably damaging 1.00
R5453:Zfp84 UTSW 7 29776297 missense possibly damaging 0.82
R5474:Zfp84 UTSW 7 29777089 missense probably damaging 1.00
R5578:Zfp84 UTSW 7 29775431 missense possibly damaging 0.93
R5646:Zfp84 UTSW 7 29776393 missense probably benign 0.05
R5963:Zfp84 UTSW 7 29776953 missense probably damaging 1.00
R6830:Zfp84 UTSW 7 29776486 missense probably benign 0.00
V3553:Zfp84 UTSW 7 29777247 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TCACTGCTGGAGCAAGGCAAAG -3'
(R):5'- ATGGGTGCAGGCTGAACGAATC -3'

Sequencing Primer
(F):5'- CCCTGGATAGTGGAGCAAGC -3'
(R):5'- GCTGAACGAATCTGGCTGAC -3'
Posted On2014-02-11