Incidental Mutation 'R1353:0610010F05Rik'
List |< first << previous [record 34 of 386652] next >> last >|
ID157103
Institutional Source Beutler Lab
Gene Symbol 0610010F05Rik
Ensembl Gene ENSMUSG00000042208
Gene NameRIKEN cDNA 0610010F05 gene
Synonyms
MMRRC Submission
Accession Numbers
Stock #R1353 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location23564961-23633631 bp(-) (GRCm38)
Type of Mutationsplice donor site (12 bp from exon)
DNA Base Change (assembly) A to T at 23620217 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105158 (fasta)
Gene Model predicted sequence gene model
Predicted Effect probably benign
Transcript: ENSMUST00000109532
SMART Domains Protein: ENSMUSP00000105158
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.1%
  • 20x: 86.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830147E19Rik T C 7: 42,616,018 D49G probably damaging Het
Astn2 T C 4: 66,266,335 Q175R possibly damaging Het
Camk2a G A 18: 60,946,977 probably benign Het
Capn9 A C 8: 124,605,566 probably null Het
Car9 G T 4: 43,512,439 probably null Het
Cdadc1 A G 14: 59,586,616 probably benign Het
Chd7 A G 4: 8,839,556 N1364S probably damaging Het
Cmya5 A T 13: 93,041,525 V3607E probably damaging Het
Col4a1 A T 8: 11,220,977 probably benign Het
Crb2 T C 2: 37,787,281 C262R probably damaging Het
Cyp2t4 A G 7: 27,156,630 N212S probably benign Het
Epha1 T C 6: 42,361,837 T676A probably damaging Het
Fancm G A 12: 65,088,170 V246M probably damaging Het
Fcrl5 T C 3: 87,448,362 S461P probably damaging Het
Gen1 A T 12: 11,243,219 L459Q probably benign Het
Gm13318 A G 2: 16,127,968 D213G probably damaging Het
Hsbp1l1 T C 18: 80,233,518 probably benign Het
Hsdl2 G T 4: 59,596,971 probably null Het
Kiz A T 2: 146,870,760 probably benign Het
Klri2 C T 6: 129,739,086 G97S probably damaging Het
Lypla2 T C 4: 135,970,467 I55V probably null Het
Map1b A G 13: 99,427,326 S2378P unknown Het
March3 A T 18: 56,776,105 S203T possibly damaging Het
Myom2 G T 8: 15,106,424 W757L probably damaging Het
Nat10 T A 2: 103,754,073 M120L possibly damaging Het
Ncam2 T G 16: 81,200,915 M1R unknown Het
Ncoa4 G T 14: 32,170,858 G33* probably null Het
Olfr1182 T C 2: 88,446,551 H129R probably benign Het
Olfr3 C A 2: 36,812,914 M59I probably benign Het
Olfr434 T A 6: 43,217,690 M259K probably benign Het
Olfr54 G A 11: 51,027,006 M1I probably null Het
Olfr768 C T 10: 129,093,864 V37I probably benign Het
Olfr890 A C 9: 38,143,728 I198L probably benign Het
Osbpl8 A G 10: 111,276,479 N485S probably damaging Het
Pkdrej A T 15: 85,818,918 V939E probably damaging Het
Plaa T C 4: 94,571,689 E607G possibly damaging Het
Riok1 T G 13: 38,060,095 probably benign Het
Rtel1 T A 2: 181,349,231 C469S probably benign Het
Rtl1 A C 12: 109,592,199 C1069G probably benign Het
Rtn4 C A 11: 29,707,595 A583E probably damaging Het
Runx1 T A 16: 92,689,051 R132* probably null Het
Sdcbp A G 4: 6,381,057 I67M probably benign Het
Sfxn1 T A 13: 54,085,637 probably benign Het
Slc22a12 G C 19: 6,537,782 L381V possibly damaging Het
Sptlc2 A G 12: 87,341,746 S321P probably damaging Het
Strc T C 2: 121,374,654 probably benign Het
Tmem30c C T 16: 57,277,665 G131D probably damaging Het
Tnfaip2 A T 12: 111,444,969 Q9L probably damaging Het
Ttn T C 2: 76,746,566 Y24661C probably damaging Het
Vmn2r77 T G 7: 86,802,186 F427V probably benign Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zfp354b A T 11: 50,923,413 H228Q probably damaging Het
Zfp84 T A 7: 29,776,175 N97K probably benign Het
Zgrf1 C T 3: 127,611,803 T1550I probably damaging Het
Other mutations in 0610010F05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:0610010F05Rik APN 11 23595434 missense probably damaging 1.00
IGL01444:0610010F05Rik APN 11 23620225 splice donor site probably benign 0.00
IGL01522:0610010F05Rik APN 11 23582865 critical splice donor site probably null 0.00
IGL01819:0610010F05Rik APN 11 23584561 missense probably damaging 1.00
IGL02470:0610010F05Rik APN 11 23615222 missense probably damaging 1.00
IGL03046:0610010F05Rik UTSW 11 23615150 missense possibly damaging 0.77
R0139:0610010F05Rik UTSW 11 23620214 splice donor site probably benign
R0334:0610010F05Rik UTSW 11 23617129 splice donor site probably benign
R0646:0610010F05Rik UTSW 11 23575491 missense probably damaging 0.99
R1078:0610010F05Rik UTSW 11 23611762 missense possibly damaging 0.64
R1263:0610010F05Rik UTSW 11 23620278 nonsense probably null
R1471:0610010F05Rik UTSW 11 23615222 missense probably damaging 1.00
R1568:0610010F05Rik UTSW 11 23589971 missense possibly damaging 0.90
R2163:0610010F05Rik UTSW 11 23576826 splice acceptor site probably benign
R2318:0610010F05Rik UTSW 11 23588701 missense probably damaging 1.00
R2426:0610010F05Rik UTSW 11 23576801 missense probably damaging 1.00
R4373:0610010F05Rik UTSW 11 23615265 unclassified probably null
R4688:0610010F05Rik UTSW 11 23593449 missense probably benign
R4816:0610010F05Rik UTSW 11 23615243 missense possibly damaging 0.67
R5046:0610010F05Rik UTSW 11 23620354 missense probably benign 0.23
R5156:0610010F05Rik UTSW 11 23593424 unclassified probably null
R5249:0610010F05Rik UTSW 11 23575483 makesense probably null
R5615:0610010F05Rik UTSW 11 23606759 missense probably damaging 0.96
X0026:0610010F05Rik UTSW 11 23576767 missense probably benign 0.00
X0067:0610010F05Rik UTSW 11 23593420 splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCAAACAAACCTTGTGAGAATTTTGTTAACCT -3'
(R):5'- CCTGGACCCAAACTCTACTGATGCTAA -3'

Sequencing Primer
(F):5'- TGAGAATTTTGTTAACCTTGTAGGC -3'
(R):5'- TCTTATGAAGGCCAAACATGGTG -3'
Posted OnFeb 11, 2014