Incidental Mutation 'R1353:Olfr54'
ID157106
Institutional Source Beutler Lab
Gene Symbol Olfr54
Ensembl Gene ENSMUSG00000059397
Gene Nameolfactory receptor 54
SynonymsGA_x6K02T2QP88-4411197-4410256, F3, MOR126-1
MMRRC Submission 039418-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R1353 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location51014236-51031578 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) G to A at 51027006 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000150809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072152] [ENSMUST00000215409] [ENSMUST00000217480]
Predicted Effect probably null
Transcript: ENSMUST00000072152
AA Change: M1I

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000072016
Gene: ENSMUSG00000059397
AA Change: M1I

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 3e-57 PFAM
Pfam:7TM_GPCR_Srsx 37 306 8.8e-6 PFAM
Pfam:7tm_1 43 291 2.7e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215409
AA Change: M1I

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably null
Transcript: ENSMUST00000217480
AA Change: M1I

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.1%
  • 20x: 86.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Astn2 T C 4: 66,266,335 Q175R unknown Het
Capn9 A C 8: 124,605,566 probably null Het
Car9 G T 4: 43,512,439 probably null Het
Chd7 A G 4: 8,839,556 N1364S probably damaging Het
Cmya5 A T 13: 93,041,525 V3607E probably damaging Het
Crb2 T C 2: 37,787,281 C262R probably damaging Het
Cyp2t4 A G 7: 27,156,630 N204S probably benign Het
Epha1 T C 6: 42,361,837 T676A probably damaging Het
Fancm G A 12: 65,088,170 V246M probably damaging Het
Fcrl5 T C 3: 87,448,362 S461P probably damaging Het
Gen1 A T 12: 11,243,219 L394Q probably benign Het
Gm13757 T C 2: 88,446,551 H129R probably benign Het
Hsdl2 G T 4: 59,596,971 probably null Het
Klri2 C T 6: 129,739,086 G97S probably damaging Het
Lypla2 T C 4: 135,970,467 I55V probably null Het
Malrd1 A G 2: 16,127,968 D1900G unknown Het
Map1b A G 13: 99,427,326 S2378P unknown Het
March3 A T 18: 56,776,105 probably null Het
Myom2 G T 8: 15,106,424 W757L probably damaging Het
Nat10 T A 2: 103,754,073 M120L possibly damaging Het
Ncam2 T G 16: 81,200,915 M1R probably null Het
Ncoa4 G T 14: 32,170,858 G33* probably null Het
Olfr3 C A 2: 36,812,914 M59I possibly damaging Het
Olfr434 T A 6: 43,217,690 M259K probably benign Het
Olfr768 C T 10: 129,093,864 V37I probably benign Het
Olfr890 A C 9: 38,143,728 I198L probably benign Het
Osbpl8 A G 10: 111,276,479 N485S probably damaging Het
Pkdrej A T 15: 85,818,918 V939E probably damaging Het
Plaa T C 4: 94,571,689 E607G possibly damaging Het
Rtel1 T A 2: 181,349,231 C285S probably benign Het
Rtl1 A C 12: 109,592,199 C1069G probably benign Het
Rtn4 C A 11: 29,707,595 A583E probably damaging Het
Runx1 T A 16: 92,689,051 R32* probably null Het
Sdcbp A G 4: 6,381,057 I67M probably damaging Het
Slc22a12 G C 19: 6,537,782 L259V possibly damaging Het
Sptlc2 A G 12: 87,341,746 S321P probably damaging Het
Tmem30c C T 16: 57,277,665 G131D probably damaging Het
Tnfaip2 A T 12: 111,444,969 Q9L probably damaging Het
Ttn T C 2: 76,746,566 Y24661C probably damaging Het
Vmn2r77 T G 7: 86,802,186 F427V probably benign Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zfp354b A T 11: 50,923,413 H228Q probably damaging Het
Zfp84 T A 7: 29,776,175 N97K probably benign Het
Zfp976 T C 7: 42,616,018 D49G probably damaging Het
Zgrf1 C T 3: 127,611,803 T1550I probably damaging Het
Other mutations in Olfr54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Olfr54 APN 11 51027589 nonsense probably null
IGL01875:Olfr54 APN 11 51027375 missense probably damaging 1.00
IGL01936:Olfr54 APN 11 51027335 missense probably benign 0.02
IGL02165:Olfr54 APN 11 51027643 missense probably benign 0.00
IGL02474:Olfr54 APN 11 51027365 missense probably damaging 1.00
IGL02706:Olfr54 APN 11 51027264 missense probably damaging 0.99
IGL02983:Olfr54 APN 11 51027380 missense probably damaging 1.00
IGL03037:Olfr54 APN 11 51027290 missense probably damaging 1.00
IGL03086:Olfr54 APN 11 51027730 missense probably damaging 1.00
R0114:Olfr54 UTSW 11 51027604 missense probably benign 0.34
R1201:Olfr54 UTSW 11 51027110 missense probably damaging 0.99
R1624:Olfr54 UTSW 11 51027125 missense probably damaging 1.00
R1961:Olfr54 UTSW 11 51027475 missense probably benign 0.00
R5318:Olfr54 UTSW 11 51027593 missense probably benign 0.01
R5335:Olfr54 UTSW 11 51027334 missense probably benign 0.00
R6409:Olfr54 UTSW 11 51027188 missense probably damaging 1.00
R7097:Olfr54 UTSW 11 51027601 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGATCTTcacacacacgcacgc -3'
(R):5'- ATGGTCCTTGTTCCAGCCACATGG -3'

Sequencing Primer
(F):5'- cacacgcacgcacacac -3'
(R):5'- GTGGTGAAGCAGACATCAAC -3'
Posted On2014-02-11