Incidental Mutation 'R1353:Ncoa4'
ID157116
Institutional Source Beutler Lab
Gene Symbol Ncoa4
Ensembl Gene ENSMUSG00000056234
Gene Namenuclear receptor coactivator 4
Synonyms
MMRRC Submission 039418-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R1353 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32159865-32179855 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 32170858 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 33 (G33*)
Ref Sequence ENSEMBL: ENSMUSP00000154536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111994] [ENSMUST00000163336] [ENSMUST00000164341] [ENSMUST00000168034] [ENSMUST00000168114] [ENSMUST00000168334] [ENSMUST00000168385] [ENSMUST00000169722] [ENSMUST00000226479]
Predicted Effect probably null
Transcript: ENSMUST00000111994
AA Change: G33*
SMART Domains Protein: ENSMUSP00000107625
Gene: ENSMUSG00000056234
AA Change: G33*

DomainStartEndE-ValueType
Pfam:ARA70 37 168 5e-44 PFAM
Pfam:ARA70 197 338 5.1e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163336
AA Change: G33*
SMART Domains Protein: ENSMUSP00000126071
Gene: ENSMUSG00000056234
AA Change: G33*

DomainStartEndE-ValueType
Pfam:ARA70 33 169 2.4e-28 PFAM
Pfam:ARA70 199 334 4.7e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164341
AA Change: G33*
SMART Domains Protein: ENSMUSP00000126780
Gene: ENSMUSG00000056234
AA Change: G33*

DomainStartEndE-ValueType
Pfam:ARA70 37 99 3.2e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168034
AA Change: G41*
SMART Domains Protein: ENSMUSP00000129422
Gene: ENSMUSG00000056234
AA Change: G41*

DomainStartEndE-ValueType
Pfam:ARA70 45 131 1.3e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168114
AA Change: G60*
SMART Domains Protein: ENSMUSP00000131253
Gene: ENSMUSG00000056234
AA Change: G60*

DomainStartEndE-ValueType
Pfam:ARA70 64 105 2.2e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168334
AA Change: G33*
SMART Domains Protein: ENSMUSP00000128739
Gene: ENSMUSG00000056234
AA Change: G33*

DomainStartEndE-ValueType
Pfam:ARA70 37 96 1.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168385
SMART Domains Protein: ENSMUSP00000126222
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 1 73 8.2e-24 PFAM
Pfam:ARA70 102 205 2.9e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169722
AA Change: G33*
SMART Domains Protein: ENSMUSP00000129917
Gene: ENSMUSG00000056234
AA Change: G33*

DomainStartEndE-ValueType
Pfam:ARA70 37 168 6.5e-45 PFAM
Pfam:ARA70 196 337 6.3e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000226479
AA Change: G33*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227498
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.1%
  • 20x: 86.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an androgen receptor coactivator. The encoded protein interacts with the androgen receptor in a ligand-dependent manner to enhance its transcriptional activity. Chromosomal translocations between this gene and the ret tyrosine kinase gene, also located on chromosome 10, have been associated with papillary thyroid carcinoma. Alternatively spliced transcript variants have been described. Pseudogenes are present on chromosomes 4, 5, 10, and 14. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mouse embryonic fibroblasts isolated from homozygous null mice exhibit abnormal DNA replication, decreased fibroblast proliferation, and early cellular replicative senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Astn2 T C 4: 66,266,335 Q175R unknown Het
Capn9 A C 8: 124,605,566 probably null Het
Car9 G T 4: 43,512,439 probably null Het
Chd7 A G 4: 8,839,556 N1364S probably damaging Het
Cmya5 A T 13: 93,041,525 V3607E probably damaging Het
Crb2 T C 2: 37,787,281 C262R probably damaging Het
Cyp2t4 A G 7: 27,156,630 N204S probably benign Het
Epha1 T C 6: 42,361,837 T676A probably damaging Het
Fancm G A 12: 65,088,170 V246M probably damaging Het
Fcrl5 T C 3: 87,448,362 S461P probably damaging Het
Gen1 A T 12: 11,243,219 L394Q probably benign Het
Gm13757 T C 2: 88,446,551 H129R probably benign Het
Hsdl2 G T 4: 59,596,971 probably null Het
Klri2 C T 6: 129,739,086 G97S probably damaging Het
Lypla2 T C 4: 135,970,467 I55V probably null Het
Malrd1 A G 2: 16,127,968 D1900G unknown Het
Map1b A G 13: 99,427,326 S2378P unknown Het
March3 A T 18: 56,776,105 probably null Het
Myom2 G T 8: 15,106,424 W757L probably damaging Het
Nat10 T A 2: 103,754,073 M120L possibly damaging Het
Ncam2 T G 16: 81,200,915 M1R probably null Het
Olfr3 C A 2: 36,812,914 M59I possibly damaging Het
Olfr434 T A 6: 43,217,690 M259K probably benign Het
Olfr54 G A 11: 51,027,006 M1I probably null Het
Olfr768 C T 10: 129,093,864 V37I probably benign Het
Olfr890 A C 9: 38,143,728 I198L probably benign Het
Osbpl8 A G 10: 111,276,479 N485S probably damaging Het
Pkdrej A T 15: 85,818,918 V939E probably damaging Het
Plaa T C 4: 94,571,689 E607G possibly damaging Het
Rtel1 T A 2: 181,349,231 C285S probably benign Het
Rtl1 A C 12: 109,592,199 C1069G probably benign Het
Rtn4 C A 11: 29,707,595 A583E probably damaging Het
Runx1 T A 16: 92,689,051 R32* probably null Het
Sdcbp A G 4: 6,381,057 I67M probably damaging Het
Slc22a12 G C 19: 6,537,782 L259V possibly damaging Het
Sptlc2 A G 12: 87,341,746 S321P probably damaging Het
Tmem30c C T 16: 57,277,665 G131D probably damaging Het
Tnfaip2 A T 12: 111,444,969 Q9L probably damaging Het
Ttn T C 2: 76,746,566 Y24661C probably damaging Het
Vmn2r77 T G 7: 86,802,186 F427V probably benign Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zfp354b A T 11: 50,923,413 H228Q probably damaging Het
Zfp84 T A 7: 29,776,175 N97K probably benign Het
Zfp976 T C 7: 42,616,018 D49G probably damaging Het
Zgrf1 C T 3: 127,611,803 T1550I probably damaging Het
Other mutations in Ncoa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Ncoa4 APN 14 32172927 missense probably benign 0.19
IGL02963:Ncoa4 APN 14 32176509 missense probably damaging 1.00
IGL03062:Ncoa4 APN 14 32173420 missense possibly damaging 0.89
R0613:Ncoa4 UTSW 14 32176552 missense probably damaging 1.00
R1395:Ncoa4 UTSW 14 32172841 intron probably null
R1430:Ncoa4 UTSW 14 32176722 missense probably benign 0.00
R1509:Ncoa4 UTSW 14 32173434 missense probably damaging 1.00
R1541:Ncoa4 UTSW 14 32176888 missense probably damaging 1.00
R2292:Ncoa4 UTSW 14 32173456 missense probably damaging 0.98
R4610:Ncoa4 UTSW 14 32176725 missense probably benign 0.01
R4713:Ncoa4 UTSW 14 32176641 missense probably benign 0.05
R5750:Ncoa4 UTSW 14 32177307 nonsense probably null
R5889:Ncoa4 UTSW 14 32166659 unclassified probably benign
R5928:Ncoa4 UTSW 14 32166721 critical splice donor site probably null
R6738:Ncoa4 UTSW 14 32170793 missense probably benign
R7065:Ncoa4 UTSW 14 32172900 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGCTTTCTAGCAGAAATAGGTTGGTG -3'
(R):5'- GATTCCCAGATTCTTCCAGCAGGAC -3'

Sequencing Primer
(F):5'- CATGTGTTGGAATCACCAAAGTTG -3'
(R):5'- TTTCCCTATGAGATCAAAAGCTCC -3'
Posted On2014-02-11