Incidental Mutation 'R0002:Bcl2'
ID 157129
Institutional Source Beutler Lab
Gene Symbol Bcl2
Ensembl Gene ENSMUSG00000057329
Gene Name B cell leukemia/lymphoma 2
Synonyms Bcl-2, C430015F12Rik, D830018M01Rik
MMRRC Submission 038298-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.910) question?
Stock # R0002 (G1)
Quality Score 79
Status Validated
Chromosome 1
Chromosomal Location 106465908-106642004 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106640241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 124 (R124G)
Ref Sequence ENSEMBL: ENSMUSP00000139856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112751] [ENSMUST00000189999]
AlphaFold P10417
Predicted Effect possibly damaging
Transcript: ENSMUST00000112751
AA Change: R124G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108371
Gene: ENSMUSG00000057329
AA Change: R124G

DomainStartEndE-ValueType
BH4 7 33 1.13e-12 SMART
BCL 94 192 4.43e-48 SMART
transmembrane domain 211 233 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189999
AA Change: R124G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139856
Gene: ENSMUSG00000057329
AA Change: R124G

DomainStartEndE-ValueType
BH4 7 33 1.13e-12 SMART
BCL 94 192 4.43e-48 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: This gene encodes a member of the B cell lymphoma 2 protein family. Members of this family regulate cell death in multiple cell types and can have either proapoptotic or antiapoptotic activities. The protein encoded by this gene inhibits mitochondrial-mediated apoptosis. This protein is an integral outer mitochondrial membrane protein that functions as part of signaling pathway that controls mitochondrial permeability in response to apoptotic stimuli. This protein may also play a role in neuron cell survival and autophagy. Abnormal expression and chromosomal translocations of this gene are associated with cancer progression in numerous tissues. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants show pleiotropic abnormalities including small size, increased postnatal mortality, polycystic kidneys, apoptotic involution of thymus and spleen, graying in the second hair follicle cycle, and reduced numbers of motor, sympathetic and sensory neurons. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(8) Gene trapped(2) Chemically induced(1)          

Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Catsper1 A G 19: 5,391,551 (GRCm39) probably benign Het
Ccdc125 C T 13: 100,830,114 (GRCm39) Q295* probably null Het
Cdhr5 G T 7: 140,849,933 (GRCm39) probably null Het
Dhx36 A C 3: 62,388,260 (GRCm39) L625W probably damaging Het
Icam5 T A 9: 20,944,801 (GRCm39) D121E probably benign Het
Ncoa1 A G 12: 4,340,885 (GRCm39) V849A probably benign Het
Nuak1 A T 10: 84,211,231 (GRCm39) W286R probably damaging Het
Pate14 A T 9: 36,548,655 (GRCm39) D59E probably damaging Het
Prkag3 T C 1: 74,783,947 (GRCm39) D312G probably damaging Het
Sbk3 T C 7: 4,973,630 (GRCm39) D17G probably damaging Het
Slc26a5 T A 5: 22,019,981 (GRCm39) I530F probably damaging Het
Spink12 T C 18: 44,240,763 (GRCm39) C50R probably damaging Het
Sult3a2 T C 10: 33,655,803 (GRCm39) I59V possibly damaging Het
Tapbp C T 17: 34,144,606 (GRCm39) A234V probably damaging Het
Tnr T C 1: 159,701,770 (GRCm39) Y624H probably damaging Het
Zfp560 T C 9: 20,258,813 (GRCm39) Y683C probably damaging Het
Other mutations in Bcl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Bcl2 APN 1 106,640,088 (GRCm39) missense possibly damaging 0.95
IGL03076:Bcl2 APN 1 106,471,037 (GRCm39) missense probably benign 0.24
Croce UTSW 1 106,471,011 (GRCm39) missense probably damaging 1.00
R0002:Bcl2 UTSW 1 106,640,241 (GRCm39) missense possibly damaging 0.94
R0083:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0086:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0107:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0183:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0217:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0219:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0346:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0347:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0348:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0361:Bcl2 UTSW 1 106,640,424 (GRCm39) missense probably damaging 0.96
R0470:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0471:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0601:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0609:Bcl2 UTSW 1 106,640,292 (GRCm39) missense probably damaging 0.99
R0965:Bcl2 UTSW 1 106,640,021 (GRCm39) missense probably benign 0.13
R1756:Bcl2 UTSW 1 106,640,122 (GRCm39) missense probably damaging 1.00
R2764:Bcl2 UTSW 1 106,640,166 (GRCm39) missense probably damaging 1.00
R4798:Bcl2 UTSW 1 106,640,338 (GRCm39) missense possibly damaging 0.57
R4922:Bcl2 UTSW 1 106,640,376 (GRCm39) missense probably benign 0.00
R6864:Bcl2 UTSW 1 106,471,011 (GRCm39) missense probably damaging 1.00
R7576:Bcl2 UTSW 1 106,640,153 (GRCm39) missense possibly damaging 0.64
R7837:Bcl2 UTSW 1 106,471,086 (GRCm39) missense possibly damaging 0.93
R8176:Bcl2 UTSW 1 106,640,528 (GRCm39) missense probably damaging 1.00
R9486:Bcl2 UTSW 1 106,471,109 (GRCm39) missense probably benign 0.40
R9548:Bcl2 UTSW 1 106,640,508 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCCTTGAGATCAAAGCCCAGAC -3'
(R):5'- TTCCAGCCTGAGAGCAACCCAATG -3'

Sequencing Primer
(F):5'- ATCCAGGTGTGCAGATGC -3'
(R):5'- ACCCAATGCCCGCTGTG -3'
Posted On 2014-02-14