Mutagenetix > Incidental Mutation

Incidental Mutation 'R0002:Dhx36'

157131

Institutional Source

Beutler Lab

Gene Symbol

Dhx36

Ensembl Gene

ENSMUSG00000027770

Gene Name

DEAH-box helicase 36

Synonyms

2810407E23Rik, Ddx36, RHAU

MMRRC Submission

038298-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0002 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

62375434-62414425 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 62388260 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Tryptophan at position 625 (L625W)

Ref Sequence

ENSEMBL: ENSMUSP00000029336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029336]

AlphaFold

Q8VHK9

Predicted Effect

probably damaging
Transcript: ENSMUST00000029336
AA Change: L625W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029336
Gene: ENSMUSG00000027770
AA Change: L625W

Domain	Start	End	E-Value	Type
low complexity region	10	45	N/A	INTRINSIC
DEXDc	198	389	1.53e-31	SMART
HELICc	495	600	5.61e-16	SMART
HA2	662	753	2.23e-26	SMART
Pfam:OB_NTP_bind	792	910	1.2e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162070

Meta Mutation Damage Score

0.1923

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.7%
20x: 96.1%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH-box family of RNA-dependent NTPases which are named after the conserved amino acid sequence Asp-Glu-Ala-His in motif II. The protein encoded by this gene has been shown to enhance the deadenylation and decay of mRNAs with 3'-UTR AU-rich elements (ARE-mRNA). The protein has also been shown to resolve into single strands the highly stable tetramolecular DNA configuration (G4) that can form spontaneously in guanine-rich regions of DNA. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality around E7.0. Mice homozygous for a conditional allele activated in the hematopoiesis systemexhibit impaired erythropoiesis associated with cell cycle defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 16 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcl2	T	C	1: 106,640,241 (GRCm39)	R124G	possibly damaging	Het
Catsper1	A	G	19: 5,391,551 (GRCm39)		probably benign	Het
Ccdc125	C	T	13: 100,830,114 (GRCm39)	Q295*	probably null	Het
Cdhr5	G	T	7: 140,849,933 (GRCm39)		probably null	Het
Icam5	T	A	9: 20,944,801 (GRCm39)	D121E	probably benign	Het
Ncoa1	A	G	12: 4,340,885 (GRCm39)	V849A	probably benign	Het
Nuak1	A	T	10: 84,211,231 (GRCm39)	W286R	probably damaging	Het
Pate14	A	T	9: 36,548,655 (GRCm39)	D59E	probably damaging	Het
Prkag3	T	C	1: 74,783,947 (GRCm39)	D312G	probably damaging	Het
Sbk3	T	C	7: 4,973,630 (GRCm39)	D17G	probably damaging	Het
Slc26a5	T	A	5: 22,019,981 (GRCm39)	I530F	probably damaging	Het
Spink12	T	C	18: 44,240,763 (GRCm39)	C50R	probably damaging	Het
Sult3a2	T	C	10: 33,655,803 (GRCm39)	I59V	possibly damaging	Het
Tapbp	C	T	17: 34,144,606 (GRCm39)	A234V	probably damaging	Het
Tnr	T	C	1: 159,701,770 (GRCm39)	Y624H	probably damaging	Het
Zfp560	T	C	9: 20,258,813 (GRCm39)	Y683C	probably damaging	Het

Other mutations in Dhx36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Dhx36	APN	3	62,377,979 (GRCm39)	utr 3 prime	probably benign
IGL00538:Dhx36	APN	3	62,408,466 (GRCm39)	missense	probably benign	0.04
IGL00706:Dhx36	APN	3	62,404,263 (GRCm39)	missense	probably damaging	1.00
IGL02040:Dhx36	APN	3	62,408,436 (GRCm39)	missense	probably benign
IGL02141:Dhx36	APN	3	62,401,310 (GRCm39)	missense	probably benign	0.25
IGL02514:Dhx36	APN	3	62,408,319 (GRCm39)	missense	possibly damaging	0.63
IGL02540:Dhx36	APN	3	62,414,309 (GRCm39)	missense	probably benign	0.07
IGL02629:Dhx36	APN	3	62,414,155 (GRCm39)	missense	probably benign	0.01
IGL02858:Dhx36	APN	3	62,384,797 (GRCm39)	splice site	probably benign
IGL03305:Dhx36	APN	3	62,408,257 (GRCm39)	nonsense	probably null
bundeswehr	UTSW	3	62,386,747 (GRCm39)	missense	probably benign
R0002:Dhx36	UTSW	3	62,388,260 (GRCm39)	missense	probably damaging	1.00
R0021:Dhx36	UTSW	3	62,385,016 (GRCm39)	missense	possibly damaging	0.66
R0021:Dhx36	UTSW	3	62,385,016 (GRCm39)	missense	possibly damaging	0.66
R0671:Dhx36	UTSW	3	62,401,162 (GRCm39)	missense	possibly damaging	0.96
R0735:Dhx36	UTSW	3	62,380,150 (GRCm39)	missense	probably benign	0.00
R0782:Dhx36	UTSW	3	62,414,135 (GRCm39)	splice site	probably benign
R1725:Dhx36	UTSW	3	62,414,360 (GRCm39)	start codon destroyed	probably benign	0.01
R1951:Dhx36	UTSW	3	62,391,694 (GRCm39)	missense	probably damaging	0.99
R1959:Dhx36	UTSW	3	62,386,806 (GRCm39)	missense	probably benign	0.01
R2257:Dhx36	UTSW	3	62,385,064 (GRCm39)	missense	probably damaging	1.00
R2397:Dhx36	UTSW	3	62,405,518 (GRCm39)	missense	probably benign	0.00
R2484:Dhx36	UTSW	3	62,380,236 (GRCm39)	missense	probably damaging	0.96
R2973:Dhx36	UTSW	3	62,402,919 (GRCm39)	missense	possibly damaging	0.56
R2973:Dhx36	UTSW	3	62,402,916 (GRCm39)	missense	probably benign	0.00
R3617:Dhx36	UTSW	3	62,394,481 (GRCm39)	missense	probably benign	0.01
R3617:Dhx36	UTSW	3	62,379,428 (GRCm39)	missense	possibly damaging	0.96
R3725:Dhx36	UTSW	3	62,395,643 (GRCm39)	splice site	probably benign
R3898:Dhx36	UTSW	3	62,399,790 (GRCm39)	missense	probably damaging	0.98
R4332:Dhx36	UTSW	3	62,392,412 (GRCm39)	missense	probably damaging	1.00
R4359:Dhx36	UTSW	3	62,382,699 (GRCm39)	missense	probably benign	0.05
R4493:Dhx36	UTSW	3	62,395,925 (GRCm39)	intron	probably benign
R4652:Dhx36	UTSW	3	62,408,419 (GRCm39)	missense	probably benign	0.01
R4866:Dhx36	UTSW	3	62,380,198 (GRCm39)	missense	probably damaging	1.00
R4884:Dhx36	UTSW	3	62,391,681 (GRCm39)	missense	probably damaging	1.00
R4960:Dhx36	UTSW	3	62,404,280 (GRCm39)	missense	probably damaging	1.00
R5083:Dhx36	UTSW	3	62,379,420 (GRCm39)	missense	probably benign	0.17
R5162:Dhx36	UTSW	3	62,401,201 (GRCm39)	missense	probably damaging	1.00
R5815:Dhx36	UTSW	3	62,401,176 (GRCm39)	missense	probably damaging	1.00
R6090:Dhx36	UTSW	3	62,404,241 (GRCm39)	missense	probably damaging	0.98
R6392:Dhx36	UTSW	3	62,401,790 (GRCm39)	missense	probably benign	0.00
R6433:Dhx36	UTSW	3	62,392,395 (GRCm39)	missense	probably damaging	1.00
R6504:Dhx36	UTSW	3	62,396,060 (GRCm39)	missense	probably benign
R6615:Dhx36	UTSW	3	62,396,338 (GRCm39)	missense	probably benign
R6672:Dhx36	UTSW	3	62,408,300 (GRCm39)	missense	probably benign	0.00
R6672:Dhx36	UTSW	3	62,402,957 (GRCm39)	missense	probably damaging	1.00
R7172:Dhx36	UTSW	3	62,408,436 (GRCm39)	missense	probably benign
R7302:Dhx36	UTSW	3	62,386,814 (GRCm39)	missense	probably benign
R7487:Dhx36	UTSW	3	62,391,623 (GRCm39)	missense	possibly damaging	0.91
R7515:Dhx36	UTSW	3	62,379,508 (GRCm39)	missense	probably benign	0.45
R7531:Dhx36	UTSW	3	62,392,389 (GRCm39)	missense	probably damaging	1.00
R7579:Dhx36	UTSW	3	62,388,294 (GRCm39)	missense	possibly damaging	0.64
R7726:Dhx36	UTSW	3	62,396,389 (GRCm39)	missense	probably benign	0.01
R7874:Dhx36	UTSW	3	62,396,052 (GRCm39)	missense	probably benign
R8056:Dhx36	UTSW	3	62,396,012 (GRCm39)	missense	possibly damaging	0.93
R8226:Dhx36	UTSW	3	62,377,991 (GRCm39)	missense	probably benign	0.01
R8361:Dhx36	UTSW	3	62,388,221 (GRCm39)	critical splice donor site	probably null
R8529:Dhx36	UTSW	3	62,414,277 (GRCm39)	small deletion	probably benign
R8737:Dhx36	UTSW	3	62,386,747 (GRCm39)	missense	probably benign
R8947:Dhx36	UTSW	3	62,380,387 (GRCm39)	missense	probably benign
R9098:Dhx36	UTSW	3	62,414,142 (GRCm39)	missense	probably benign	0.00
R9098:Dhx36	UTSW	3	62,414,141 (GRCm39)	nonsense	probably null
R9209:Dhx36	UTSW	3	62,378,895 (GRCm39)	missense	probably benign	0.21
R9718:Dhx36	UTSW	3	62,379,466 (GRCm39)	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- GAACCAAACATAGGCACCCTGATTCTAA -3'
(R):5'- GGGAATTGAGTGCCATAGACATGAAGT -3'

Sequencing Primer
(F):5'- tgagcagaatccacagcaag -3'
(R):5'- AGGAATGGATACTGGGTGCTTTC -3'

Posted On

2014-02-14